rs1553331676

Variant names:

• chr2-47803625-AGCCTATTGTGTGCTTGTTACTGGACCAAATATGGGGGGCAAGTCTACGCTTATGAGACAGGTAAC-A
• rs1553331676
• NM_000179.3:c.3379_3438+5delGCCTATTGTGTGCTTGTTACTGGACCAAATATGGGGGGCAAGTCTACGCTTATGAGACAGGTAAC

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_000179.3(MSH6):​c.3379_3438+5delGCCTATTGTGTGCTTGTTACTGGACCAAATATGGGGGGCAAGTCTACGCTTATGAGACAGGTAAC​(p.Ala1127_Gln1146del) variant causes a splice donor, conservative inframe deletion, splice region, intron change involving the alteration of a conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★★). Synonymous variant affecting the same amino acid position (i.e. A1127A) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.0000066 (0 hom., cov: 32)
  • Failed GnomAD Quality Control
• Consequence: MSH6 NM_000179.3 splice_donor, conservative_inframe_deletion, splice_region, intron
• Clinical Significance: Pathogenic reviewed by expert panel P:8
• Conservation: PhyloP100: 9.97
• Publications: 1 publications found

Genes affected

MSH6 (HGNC:7329): (mutS homolog 6) This gene encodes a member of the DNA mismatch repair MutS family. In E. coli, the MutS protein helps in the recognition of mismatched nucleotides prior to their repair. A highly conserved region of approximately 150 aa, called the Walker-A adenine nucleotide binding motif, exists in MutS homologs. The encoded protein heterodimerizes with MSH2 to form a mismatch recognition complex that functions as a bidirectional molecular switch that exchanges ADP and ATP as DNA mismatches are bound and dissociated. Mutations in this gene may be associated with hereditary nonpolyposis colon cancer, colorectal cancer, and endometrial cancer. Transcripts variants encoding different isoforms have been described. [provided by RefSeq, Jul 2013]

FBXO11 (HGNC:13590): (F-box protein 11) This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. It can function as an arginine methyltransferase that symmetrically dimethylates arginine residues, and it acts as an adaptor protein to mediate the neddylation of p53, which leads to the suppression of p53 function. This gene is known to be down-regulated in melanocytes from patients with vitiligo, a skin disorder that results in depigmentation. Polymorphisms in this gene are associated with chronic otitis media with effusion and recurrent otitis media (COME/ROM), a hearing loss disorder, and the knockout of the homologous mouse gene results in the deaf mouse mutant Jeff (Jf), a single gene model of otitis media. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jun 2010]

FBXO11 Gene-Disease associations (from GenCC):

• intellectual developmental disorder with dysmorphic facies and behavioral abnormalities

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, G2P, Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, LoF is a know mechanism of disease, No cryptic splice site detected. Exon removal results in frameshift change.
• PP5: Variant 2-47803625-AGCCTATTGTGTGCTTGTTACTGGACCAAATATGGGGGGCAAGTCTACGCTTATGAGACAGGTAAC-A is Pathogenic according to our data. Variant chr2-47803625-AGCCTATTGTGTGCTTGTTACTGGACCAAATATGGGGGGCAAGTCTACGCTTATGAGACAGGTAAC-A is described in ClinVar as Pathogenic. ClinVar VariationId is 89377.Status of the report is reviewed_by_expert_panel, 3 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000179.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MSH6	NM_000179.3	MANE Select	c.3379_3438+5delGCCTATTGTGTGCTTGTTACTGGACCAAATATGGGGGGCAAGTCTACGCTTATGAGACAGGTAAC	p.Ala1127_Gln1146del	splice_donor conservative_inframe_deletion splice_region intron	Exon 5 of 10	NP_000170.1	P52701-1
	MSH6	NM_001406795.1		c.3475_3534+5delGCCTATTGTGTGCTTGTTACTGGACCAAATATGGGGGGCAAGTCTACGCTTATGAGACAGGTAAC	p.Ala1159_Gln1178del	splice_donor conservative_inframe_deletion splice_region intron	Exon 6 of 11	NP_001393724.1
	MSH6	NM_001406813.1		c.3385_3444+5delGCCTATTGTGTGCTTGTTACTGGACCAAATATGGGGGGCAAGTCTACGCTTATGAGACAGGTAAC	p.Ala1129_Gln1148del	splice_donor conservative_inframe_deletion splice_region intron	Exon 5 of 10	NP_001393742.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MSH6	ENST00000234420.11	TSL:1 MANE Select	c.3379_3438+5delGCCTATTGTGTGCTTGTTACTGGACCAAATATGGGGGGCAAGTCTACGCTTATGAGACAGGTAAC	p.Ala1127_Gln1146del	splice_donor conservative_inframe_deletion splice_region intron	Exon 5 of 10	ENSP00000234420.5	P52701-1
	MSH6	ENST00000445503.5	TSL:1	n.*2726_*2785+5delGCCTATTGTGTGCTTGTTACTGGACCAAATATGGGGGGCAAGTCTACGCTTATGAGACAGGTAAC		splice_region non_coding_transcript_exon	Exon 4 of 9	ENSP00000405294.1	F8WAX8
	MSH6	ENST00000445503.5	TSL:1	n.*2726_*2785+5delGCCTATTGTGTGCTTGTTACTGGACCAAATATGGGGGGCAAGTCTACGCTTATGAGACAGGTAAC		splice_donor splice_region 3_prime_UTR intron	Exon 4 of 9	ENSP00000405294.1	F8WAX8

Frequencies

GnomAD3 genomes AF: 0.00000657 AC: 1 AN: 152168 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000147

Gnomad OTH AF: 0.00

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000657 AC: 1 AN: 152168 Hom.: 0 Cov.: 32 AF XY: 0.00 AC XY: 0 AN XY: 74340

African (AFR) AF: 0.00 AC: 0 AN: 41450

American (AMR) AF: 0.00 AC: 0 AN: 15276

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3472

East Asian (EAS) AF: 0.00 AC: 0 AN: 5192

South Asian (SAS) AF: 0.00 AC: 0 AN: 4824

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10612

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.0000147 AC: 1 AN: 68024

Other (OTH) AF: 0.00 AC: 0 AN: 2092

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: reviewed by expert panel

Pathogenic	VUS	Benign	Condition
3	-	-	not provided (3)
2	-	-	Hereditary cancer-predisposing syndrome (2)
1	-	-	Hereditary nonpolyposis colorectal neoplasms (1)
1	-	-	Lynch syndrome (1)
1	-	-	Lynch syndrome 5 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		10
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1553331676; hg19: chr2-48030764;