rs1553331676

Variant names:

• chr2-47803625-AGCCTATTGTGTGCTTGTTACTGGACCAAATATGGGGGGCAAGTCTACGCTTATGAGACAGGTAAC-A
• rs1553331676
• ENST00000445503.5:n.*2726_*2785+5delGCCTATTGTGTGCTTGTTACTGGACCAAATATGGGGGGCAAGTCTACGCTTATGAGACAGGTAAC

Variant summary

Our verdict is Likely pathogenic. The variant received 9 ACMG points: 9P and 0B. PP3 PP5_Very_Strong

The ENST00000445503.5(MSH6):​n.*2726_*2785+5delGCCTATTGTGTGCTTGTTACTGGACCAAATATGGGGGGCAAGTCTACGCTTATGAGACAGGTAAC variant causes a splice region, non coding transcript exon change involving the alteration of a conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★★).

• Frequency:
  • Genomes: 𝑓 0.0000066 (0 hom., cov: 32)
  • Failed GnomAD Quality Control
• Consequence: MSH6 ENST00000445503.5 splice_region, non_coding_transcript_exon
• Clinical Significance: Pathogenic reviewed by expert panel P:8
• Conservation: PhyloP100: 9.97
• Publications: 1 publications found

Genes affected

MSH6 (HGNC:7329): (mutS homolog 6) This gene encodes a member of the DNA mismatch repair MutS family. In E. coli, the MutS protein helps in the recognition of mismatched nucleotides prior to their repair. A highly conserved region of approximately 150 aa, called the Walker-A adenine nucleotide binding motif, exists in MutS homologs. The encoded protein heterodimerizes with MSH2 to form a mismatch recognition complex that functions as a bidirectional molecular switch that exchanges ADP and ATP as DNA mismatches are bound and dissociated. Mutations in this gene may be associated with hereditary nonpolyposis colon cancer, colorectal cancer, and endometrial cancer. Transcripts variants encoding different isoforms have been described. [provided by RefSeq, Jul 2013]

FBXO11 (HGNC:13590): (F-box protein 11) This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. It can function as an arginine methyltransferase that symmetrically dimethylates arginine residues, and it acts as an adaptor protein to mediate the neddylation of p53, which leads to the suppression of p53 function. This gene is known to be down-regulated in melanocytes from patients with vitiligo, a skin disorder that results in depigmentation. Polymorphisms in this gene are associated with chronic otitis media with effusion and recurrent otitis media (COME/ROM), a hearing loss disorder, and the knockout of the homologous mouse gene results in the deaf mouse mutant Jeff (Jf), a single gene model of otitis media. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jun 2010]

FBXO11 Gene-Disease associations (from GenCC):

• intellectual developmental disorder with dysmorphic facies and behavioral abnormalities

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P

ACMG classification

Our verdict: Likely_pathogenic. The variant received 9 ACMG points.

• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 2-47803625-AGCCTATTGTGTGCTTGTTACTGGACCAAATATGGGGGGCAAGTCTACGCTTATGAGACAGGTAAC-A is Pathogenic according to our data. Variant chr2-47803625-AGCCTATTGTGTGCTTGTTACTGGACCAAATATGGGGGGCAAGTCTACGCTTATGAGACAGGTAAC-A is described in ClinVar as Pathogenic. ClinVar VariationId is 89377.Status of the report is reviewed_by_expert_panel, 3 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: ENST00000445503.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MSH6	NM_000179.3	MANE Select	c.3379_3438+5delGCCTATTGTGTGCTTGTTACTGGACCAAATATGGGGGGCAAGTCTACGCTTATGAGACAGGTAAC	p.Ala1127_Gln1146del	splice_donor conservative_inframe_deletion splice_region intron	Exon 5 of 10	NP_000170.1
	MSH6	NM_001406795.1		c.3475_3534+5delGCCTATTGTGTGCTTGTTACTGGACCAAATATGGGGGGCAAGTCTACGCTTATGAGACAGGTAAC	p.Ala1159_Gln1178del	splice_donor conservative_inframe_deletion splice_region intron	Exon 6 of 11	NP_001393724.1
	MSH6	NM_001406813.1		c.3385_3444+5delGCCTATTGTGTGCTTGTTACTGGACCAAATATGGGGGGCAAGTCTACGCTTATGAGACAGGTAAC	p.Ala1129_Gln1148del	splice_donor conservative_inframe_deletion splice_region intron	Exon 5 of 10	NP_001393742.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MSH6	ENST00000445503.5	TSL:1	n.*2726_*2785+5delGCCTATTGTGTGCTTGTTACTGGACCAAATATGGGGGGCAAGTCTACGCTTATGAGACAGGTAAC		splice_region non_coding_transcript_exon	Exon 4 of 9	ENSP00000405294.1
	MSH6	ENST00000234420.11	TSL:1 MANE Select	c.3379_3438+5delGCCTATTGTGTGCTTGTTACTGGACCAAATATGGGGGGCAAGTCTACGCTTATGAGACAGGTAAC	p.Ala1127_Gln1146del	splice_donor conservative_inframe_deletion splice_region intron	Exon 5 of 10	ENSP00000234420.5
	MSH6	ENST00000445503.5	TSL:1	n.*2726_*2785+5delGCCTATTGTGTGCTTGTTACTGGACCAAATATGGGGGGCAAGTCTACGCTTATGAGACAGGTAAC		splice_donor splice_region 3_prime_UTR intron	Exon 4 of 9	ENSP00000405294.1

Frequencies

GnomAD3 genomes AF: 0.00000657 AC: 1 AN: 152168 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000147

Gnomad OTH AF: 0.00

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000657 AC: 1 AN: 152168 Hom.: 0 Cov.: 32 AF XY: 0.00 AC XY: 0 AN XY: 74340

African (AFR) AF: 0.00 AC: 0 AN: 41450

American (AMR) AF: 0.00 AC: 0 AN: 15276

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3472

East Asian (EAS) AF: 0.00 AC: 0 AN: 5192

South Asian (SAS) AF: 0.00 AC: 0 AN: 4824

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10612

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.0000147 AC: 1 AN: 68024

Other (OTH) AF: 0.00 AC: 0 AN: 2092

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:8

Revision: reviewed by expert panel

Submissions by phenotype

not provided Pathogenic:3

Dec 03, 2020

GeneDx

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Canonical splice site variant in a gene for which loss-of-function is a known mechanism of disease; Truncating variants in this gene are considered pathogenic by a well-established clinical consortium and/or database; Observed in an individual with early onset colon cancer demonstrating microsatellite instability and loss of MSH6 protein expression (Steinke 2008); Not observed in large population cohorts (Lek 2016); This variant is associated with the following publications: (PMID: 18301448)

May 04, 2022

Revvity Omics, Revvity

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

May 08, 2024

Quest Diagnostics Nichols Institute San Juan Capistrano

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The MSH6 c.3379_3438+5del (p.Tyr1128_Ala1147del) variant has been reported in the published literature in an individual with Lynch syndrome associated tumor (colon cancer) showing loss of MSH6 protein expression and microsatellite instability (PMID: 18301448 (2008)). This variant was observed to result in abnormal splicing (personal communication with Ambry Genetics related to ClinVar ID: 89377. This variant has not been reported in large, multi-ethnic general populations (Genome Aggregation Database, http://gnomad.broadinstitute.org). Analysis of this variant using software algorithms for the prediction of the effect of nucleotide changes on splicing yielded predictions that this variant may affect proper MSH6 mRNA splicing. Based on the available information, this variant is classified as pathogenic.

Hereditary cancer-predisposing syndrome Pathogenic:2

Dec 04, 2023

Ambry Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.3379_3438+5del65 pathogenic mutation results from a deletion of 65 nucleotides between positions 3379 and 3438+5 and involves the canonical splice donor site after coding exon 5 of the MSH6 gene. This variant has been identified in a proband(s) whose Lynch syndrome-associated tumor demonstrated high microsatellite instability and/or loss of MSH6 expression by immunohistochemistry (Ambry internal data; Steinke V et al. Eur. J. Hum. Genet. 2008 May;16(5):587-92). This variant is considered to be rare based on population cohorts in the Genome Aggregation Database (gnomAD). In silico splice site analysis predicts that this alteration will weaken the native splice donor site. RNA studies have demonstrated that this alteration results in abnormal splicing in the set of samples tested (Ambry internal data). Based on the supporting evidence, this alteration is interpreted as a disease-causing mutation.

Jun 26, 2019

Color Diagnostics, LLC DBA Color Health

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Lynch syndrome 5 Pathogenic:1

Aug 22, 2023

Myriad Genetics, Inc.

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant is considered pathogenic. This variant occurs within a consensus splice junction and is predicted to result in abnormal mRNA splicing of either an out-of-frame exon or an in-frame exon necessary for protein stability and/or normal function.

Lynch syndrome Pathogenic:1

Sep 05, 2013

International Society for Gastrointestinal Hereditary Tumours (InSiGHT)

Significance: Pathogenic

Review Status: reviewed by expert panel

Collection Method: research

Coding sequence variation resulting in a stop codon (also interrupts canonical donor splice site)

Hereditary nonpolyposis colorectal neoplasms Pathogenic:1

Dec 11, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant results in the deletion of part of exon 5 (c.3379_3438+5del) of the MSH6 gene. It is expected to disrupt RNA splicing. Variants that disrupt the donor or acceptor splice site typically lead to a loss of protein function (PMID: 16199547), and loss-of-function variants in MSH6 are known to be pathogenic (PMID: 18269114, 24362816). This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individuals with clinical features of Lynch syndrome (PMID: 18301448; internal data). Invitae Evidence Modeling of clinical and family history, age, sex, and reported ancestry of multiple individuals with this MSH6 variant has been performed. This variant is expected to be pathogenic with a positive predictive value of at least 99%. This is a validated machine learning model that incorporates the clinical features of 1,370,736 individuals referred to our laboratory for MSH6 testing. ClinVar contains an entry for this variant (Variation ID: 89377). Studies have shown that this variant is associated with altered splicing resulting in unknown protein product impact (internal data). For these reasons, this variant has been classified as Pathogenic.

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		10
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1553331676; hg19: chr2-48030764;