rs1553333584

Variant names:

• chr2-47806566-G-GCTAATCTCCCAGAGGAAGTTAT
• rs1553333584
• NM_000179.3:c.3917_3938dupCTAATCTCCCAGAGGAAGTTAT

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_000179.3(MSH6):​c.3917_3938dupCTAATCTCCCAGAGGAAGTTAT​(p.Gln1314fs) variant causes a frameshift, stop gained change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: MSH6 NM_000179.3 frameshift, stop_gained
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:2
• Conservation: PhyloP100: 7.81
• Publications: 0 publications found

Genes affected

MSH6 (HGNC:7329): (mutS homolog 6) This gene encodes a member of the DNA mismatch repair MutS family. In E. coli, the MutS protein helps in the recognition of mismatched nucleotides prior to their repair. A highly conserved region of approximately 150 aa, called the Walker-A adenine nucleotide binding motif, exists in MutS homologs. The encoded protein heterodimerizes with MSH2 to form a mismatch recognition complex that functions as a bidirectional molecular switch that exchanges ADP and ATP as DNA mismatches are bound and dissociated. Mutations in this gene may be associated with hereditary nonpolyposis colon cancer, colorectal cancer, and endometrial cancer. Transcripts variants encoding different isoforms have been described. [provided by RefSeq, Jul 2013]

FBXO11 (HGNC:13590): (F-box protein 11) This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. It can function as an arginine methyltransferase that symmetrically dimethylates arginine residues, and it acts as an adaptor protein to mediate the neddylation of p53, which leads to the suppression of p53 function. This gene is known to be down-regulated in melanocytes from patients with vitiligo, a skin disorder that results in depigmentation. Polymorphisms in this gene are associated with chronic otitis media with effusion and recurrent otitis media (COME/ROM), a hearing loss disorder, and the knockout of the homologous mouse gene results in the deaf mouse mutant Jeff (Jf), a single gene model of otitis media. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jun 2010]

FBXO11 Gene-Disease associations (from GenCC):

• intellectual developmental disorder with dysmorphic facies and behavioral abnormalities

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 2-47806566-G-GCTAATCTCCCAGAGGAAGTTAT is Pathogenic according to our data. Variant chr2-47806566-G-GCTAATCTCCCAGAGGAAGTTAT is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 433927.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MSH6	NM_000179.3	c.3917_3938dupCTAATCTCCCAGAGGAAGTTAT	p.Gln1314fs	frameshift_variant, stop_gained	Exon 9 of 10	ENST00000234420.11	NP_000170.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MSH6	ENST00000234420.11	c.3917_3938dupCTAATCTCCCAGAGGAAGTTAT	p.Gln1314fs	frameshift_variant, stop_gained	Exon 9 of 10	1	NM_000179.3	ENSP00000234420.5

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 35

GnomAD4 genome Cov.: 32

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:2

Revision: criteria provided, single submitter

Submissions by phenotype

Carcinoma of colon Pathogenic:1

-

Department of Pathology and Laboratory Medicine, Sinai Health System

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: clinical testing

The MSH6 p.Gln1314X variant was not identified in the literature nor was it identified in the dbSNP, Clinvitae database, COSMIC, “Mismatch Repair Genes Variant Database”, “MMR Gene Unclassified Variants Database”, InSiGHT Colon Cancer Gene Variant Database (LOVD), Zhejiang Colon Cancer Database (LOVD), ClinVar database, GeneInsight - COGR database, UMD, NHLBI GO Exome Sequencing Project and the Exome Aggregation Consortium database (August 8, 2016) databases. The variant occurs outside of the splicing consensus sequence and 4 of 5 in silico or computational prediction software programs (SpliceSiteFinder, MaxEntScan, NNSPLICE, GeneSplicer, HumanSpliceFinder) predict a greater than 10% difference in splicing. However, this information is not predictive enough to assume pathogenicity. The c.3917_3938dup variant is predicted to cause a frameshift, which alters the protein's amino acid sequence and leads to a premature stop codon at position 1314. This alteration is then predicted to result in a truncated or absent protein and loss of function. Loss of function variants of the MSH6 gene are an established mechanism of disease in Lynch syndrome and this is the type of variant expected to cause the disorder. In summary, based on the above information, this variant meets our laboratory’s criteria to be classified as pathogenic. -

Breast and/or ovarian cancer Pathogenic:1

Jun 08, 2021

CHEO Genetics Diagnostic Laboratory, Children's Hospital of Eastern Ontario

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		7.8
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1553333584; hg19: chr2-48033705;