rs1553333644

Variant names:

• chr2-47806584-G-GTTATTCAAAAGGGACATAGA
• rs1553333644
• NM_000179.3:c.3935_3954dupTTATTCAAAAGGGACATAGA

Variant summary

Our verdict is Pathogenic. The variant received 18 ACMG points: 18P and 0B. PVS1 PM2 PP5_Very_Strong

The NM_001406800.1(MSH6):​c.3922_3941dupTTATTCAAAAGGGACATAGA​(p.Glu1314AspfsTer7) variant causes a frameshift, stop gained change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: MSH6 NM_001406800.1 frameshift, stop_gained
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:3
• Conservation: PhyloP100: 7.99

Genes affected

MSH6 (HGNC:7329): (mutS homolog 6) This gene encodes a member of the DNA mismatch repair MutS family. In E. coli, the MutS protein helps in the recognition of mismatched nucleotides prior to their repair. A highly conserved region of approximately 150 aa, called the Walker-A adenine nucleotide binding motif, exists in MutS homologs. The encoded protein heterodimerizes with MSH2 to form a mismatch recognition complex that functions as a bidirectional molecular switch that exchanges ADP and ATP as DNA mismatches are bound and dissociated. Mutations in this gene may be associated with hereditary nonpolyposis colon cancer, colorectal cancer, and endometrial cancer. Transcripts variants encoding different isoforms have been described. [provided by RefSeq, Jul 2013]

FBXO11 (HGNC:13590): (F-box protein 11) This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. It can function as an arginine methyltransferase that symmetrically dimethylates arginine residues, and it acts as an adaptor protein to mediate the neddylation of p53, which leads to the suppression of p53 function. This gene is known to be down-regulated in melanocytes from patients with vitiligo, a skin disorder that results in depigmentation. Polymorphisms in this gene are associated with chronic otitis media with effusion and recurrent otitis media (COME/ROM), a hearing loss disorder, and the knockout of the homologous mouse gene results in the deaf mouse mutant Jeff (Jf), a single gene model of otitis media. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jun 2010]

ACMG classification

Our verdict: Pathogenic. The variant received 18 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 2-47806584-G-GTTATTCAAAAGGGACATAGA is Pathogenic according to our data. Variant chr2-47806584-G-GTTATTCAAAAGGGACATAGA is described in ClinVar as [Pathogenic]. Clinvar id is 428331.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MSH6	NM_000179.3	c.3935_3954dupTTATTCAAAAGGGACATAGA	p.Lys1319LeufsTer15	frameshift_variant	Exon 9 of 10	ENST00000234420.11	NP_000170.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MSH6	ENST00000234420.11	c.3935_3954dupTTATTCAAAAGGGACATAGA	p.Lys1319LeufsTer15	frameshift_variant	Exon 9 of 10	1	NM_000179.3	ENSP00000234420.5

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 35

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:3

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Lynch syndrome Pathogenic:1

Sep 03, 2024

All of Us Research Program, National Institutes of Health

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.3935_3954dup variant in the MSH6 gene is located on the exon 9 and is predicted to cause shift of reading frame which introduces a premature translation termination codon (p.Lys1319Leufs*15), resulting in an absent or disrupted protein product. This variant has not been reported in individuals affected with MSH6-related disease in literature. Other frameshift and protein termination codon variants located at the same location (p.Lys1319_Ala1320insSerLysGlyThr*, p.Ala1320Glufs*6) have been reported from individuals with Lynch syndrome-related cancer and interpreted as pathogenic by the expert panel (ClinVar ID: 89486, 89488). Loss-of-function variants of MSH6 are known to be pathogenic (PMID: 30376427, 18269114, 29345684). This variant has been reported as pathogenic in ClinVar (ID: 428331). The variant is absent in the general population according to gnomAD (v4.1). Therefore, the c.3935_3954dup (p.Lys1319Leufs*15) variant in the MSH6 gene has been classified as pathogenic. -

Hereditary nonpolyposis colorectal neoplasms Pathogenic:1

Feb 20, 2017

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change inserts 20 nucleotides in exon 9 of the MSH6 mRNA (c.3935_3954dup20), causing a frameshift at codon 1319. This creates a premature translational stop signal in the penultimate exon of the MSH6 mRNA (p.Lys1319Leufs*15). While this is not anticipated to result in nonsense-mediated decay, it is expected to disrupt the last 42 amino acids of the MSH6 protein. Two similar MSH6 variants, c.3959_3962delCAAG (p.Ala1320Glufs*6) and c.3984_3987dupGTCA (p.Leu1330Valfs*12), have been reported as Ashkenazi Jewish founder mutations known to cause Lynch syndrome (PMID: 21155762). This variant is not expected to result in nonsense-mediated decay, but it is expected to disrupt amino acid residues Lys1319-Leu1360 of the MSH6 protein. Although no functional studies have been performed to test the effects of this particular variant on MSH6 protein function or stability, it is expected to delete the C-terminal portion of the conserved MutS domain (PMID: 17531815, 24100870). This domain is necessary for the heterodimerization of MSH6 and MSH2 (PMID: 15952900, 16464007). This variant has not been reported in the literature in individuals with an MSH6-related disease. For these reasons, this variant has been classified as Pathogenic. -

Hereditary cancer-predisposing syndrome Pathogenic:1

Jun 07, 2018

Ambry Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.3935_3954dup20 pathogenic mutation, located in coding exon 9 of the MSH6 gene, results from a duplication of 20 nucleotides at positions 3935 to 3954, causing a translational frameshift with a predicted alternate stop codon (p.K1319Lfs*15). This alteration was identified in a patient whose colorectal cancer exhibited loss of MSH6 on IHC (Ambry internal data). This frameshift occurs at the 3' terminus of MSH6, is not expected to trigger nonsense-mediated mRNA decay, and impacts the last 42 amino acids of the protein. The exact functional impact of these altered amino acids is unknown at this time; however, this alteration disrupts the last 16 amino acids of an important MSH6 functional domain. Based on the supporting evidence, this alteration is interpreted as a disease-causing mutation. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1553333644; hg19: chr2-48033723;