rs1553348901

Variant names:

• chr2-47403391-TGGGGCCGGCAGGTGAGGGCCGGGACGGCGCGTGCTGGGGAGGGACCC-T
• rs1553348901
• NM_000251.3:c.207_211+42delGGCAGGTGAGGGCCGGGACGGCGCGTGCTGGGGAGGGACCCGGGGCC

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_000251.3(MSH2):​c.207_211+42delGGCAGGTGAGGGCCGGGACGGCGCGTGCTGGGGAGGGACCCGGGGCC​(p.Ala70IlefsTer4) variant causes a frameshift, splice donor, splice region, intron change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. P69P) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 33)
• Consequence: MSH2 NM_000251.3 frameshift, splice_donor, splice_region, intron
• Clinical Significance: Likely pathogenic criteria provided, multiple submitters, no conflicts P:3
• Conservation: PhyloP100: 5.71
• Publications: 0 publications found

Genes affected

MSH2 (HGNC:7325): (mutS homolog 2) This locus is frequently mutated in hereditary nonpolyposis colon cancer (HNPCC). When cloned, it was discovered to be a human homolog of the E. coli mismatch repair gene mutS, consistent with the characteristic alterations in microsatellite sequences (RER+ phenotype) found in HNPCC. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]

MSH2 Gene-Disease associations (from GenCC):

• Lynch syndrome

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, ClinGen, Orphanet
• Lynch syndrome 1

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp, Ambry Genetics
• Muir-Torre syndrome

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Orphanet, G2P
• mismatch repair cancer syndrome 1

  Inheritance: AR Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
• mismatch repair cancer syndrome 2

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P
• ovarian cancer

  Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
• malignant pancreatic neoplasm

  Inheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
• prostate cancer

  Inheritance: AD Classification: MODERATE Submitted by: Ambry Genetics
• rhabdomyosarcoma

  Inheritance: AR Classification: MODERATE Submitted by: Genomics England PanelApp
• breast cancer

  Inheritance: AD Classification: NO_KNOWN Submitted by: Ambry Genetics
• hereditary breast carcinoma

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 2-47403391-TGGGGCCGGCAGGTGAGGGCCGGGACGGCGCGTGCTGGGGAGGGACCC-T is Pathogenic according to our data. Variant chr2-47403391-TGGGGCCGGCAGGTGAGGGCCGGGACGGCGCGTGCTGGGGAGGGACCC-T is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 455540.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MSH2	NM_000251.3	c.207_211+42delGGCAGGTGAGGGCCGGGACGGCGCGTGCTGGGGAGGGACCCGGGGCC	p.Ala70IlefsTer4	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 1 of 16	ENST00000233146.7	NP_000242.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MSH2	ENST00000233146.7	c.201_211+36delGGGGCCGGCAGGTGAGGGCCGGGACGGCGCGTGCTGGGGAGGGACCC	p.Gly68IlefsTer4	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 1 of 16	1	NM_000251.3	ENSP00000233146.2

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:3

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Lynch syndrome 1 Pathogenic:1

Jul 26, 2023

Myriad Genetics, Inc.

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant is considered likely pathogenic. This variant occurs within a consensus splice junction and is predicted to result in abnormal mRNA splicing of either an out-of-frame exon or an in-frame exon necessary for protein stability and/or normal function. -

Hereditary nonpolyposis colorectal neoplasms Pathogenic:1

Aug 20, 2023

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

In summary, the currently available evidence indicates that the variant is pathogenic, but additional data are needed to prove that conclusively. Therefore, this variant has been classified as Likely Pathogenic. ClinVar contains an entry for this variant (Variation ID: 455540). This variant has not been reported in the literature in individuals affected with MSH2-related conditions. This variant is not present in population databases (gnomAD no frequency). This variant results in the deletion of part of exon 1 of the MSH2 gene. It is expected to disrupt RNA splicing. Variants that disrupt the donor or acceptor splice site typically lead to a loss of protein function (PMID: 16199547), and loss-of-function variants in MSH2 are known to be pathogenic (PMID: 15849733, 24362816). -

Hereditary cancer-predisposing syndrome Pathogenic:1

Nov 22, 2024

Ambry Genetics

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.207_211+42del47 variant results from a deletion of 47 nucleotides between positions c.207 and c.211+42 and involves the canonical splice donor site after coding exon 1 of the MSH2 gene. This variant has been identified in probands whose Lynch syndrome-associated tumor demonstrated loss of MSH2/MSH6 expression by immunohistochemistry and/or high microsatellite instability (Li S et al. J. Med. Genet. 2020 Jan;57:62-69; Ambry internal data). This variant is considered to be rare based on population cohorts in the Genome Aggregation Database (gnomAD). The canonical splice donor site is well conserved in available vertebrate species. In silico splice site analysis predicts that this alteration will weaken the native splice donor site and will and will result in the creation or strengthening of a novel splice donor site; however, direct evidence is insufficient at this time (Ambry internal data). Alterations that disrupt the canonical splice site are expected to cause aberrant splicing, resulting in an abnormal protein or a transcript that is subject to nonsense-mediated mRNA decay. As such, this alteration is classified as likely pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		5.7

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1553348901; hg19: chr2-47630530;