rs1553348901

Variant summary

Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1PM2PP5_Very_Strong

The NM_000251.3(MSH2):​c.207_211+42delGGCAGGTGAGGGCCGGGACGGCGCGTGCTGGGGAGGGACCCGGGGCC​(p.Ala70fs) variant causes a frameshift, splice donor, splice region, intron change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★★). Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 33)

Consequence

MSH2
NM_000251.3 frameshift, splice_donor, splice_region, intron

Scores

Not classified

Clinical Significance

Likely pathogenic criteria provided, multiple submitters, no conflicts P:3

Conservation

PhyloP100: 5.71
Variant links:
Genes affected
MSH2 (HGNC:7325): (mutS homolog 2) This locus is frequently mutated in hereditary nonpolyposis colon cancer (HNPCC). When cloned, it was discovered to be a human homolog of the E. coli mismatch repair gene mutS, consistent with the characteristic alterations in microsatellite sequences (RER+ phenotype) found in HNPCC. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 18 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 2-47403391-TGGGGCCGGCAGGTGAGGGCCGGGACGGCGCGTGCTGGGGAGGGACCC-T is Pathogenic according to our data. Variant chr2-47403391-TGGGGCCGGCAGGTGAGGGCCGGGACGGCGCGTGCTGGGGAGGGACCC-T is described in ClinVar as [Likely_pathogenic]. Clinvar id is 455540.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars. Variant chr2-47403391-TGGGGCCGGCAGGTGAGGGCCGGGACGGCGCGTGCTGGGGAGGGACCC-T is described in Lovd as [Pathogenic].

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect #exon/exons MANE Protein UniProt
MSH2NM_000251.3 linkuse as main transcriptc.207_211+42delGGCAGGTGAGGGCCGGGACGGCGCGTGCTGGGGAGGGACCCGGGGCC p.Ala70fs frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant 1/16 ENST00000233146.7 NP_000242.1 P43246-1

Ensembl

Gene Transcript HGVSc HGVSp Effect #exon/exons TSL MANE Protein Appris UniProt
MSH2ENST00000233146.7 linkuse as main transcriptc.207_211+42delGGCAGGTGAGGGCCGGGACGGCGCGTGCTGGGGAGGGACCCGGGGCC p.Ala70fs frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant 1/161 NM_000251.3 ENSP00000233146.2 P43246-1

Frequencies

GnomAD3 genomes
Cov.:
33
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
33

ClinVar

Significance: Likely pathogenic
Submissions summary: Pathogenic:3
Revision: criteria provided, multiple submitters, no conflicts
LINK: link

Submissions by phenotype

Lynch syndrome 1 Pathogenic:1
Likely pathogenic, criteria provided, single submitterclinical testingMyriad Genetics, Inc.Jul 26, 2023This variant is considered likely pathogenic. This variant occurs within a consensus splice junction and is predicted to result in abnormal mRNA splicing of either an out-of-frame exon or an in-frame exon necessary for protein stability and/or normal function. -
Hereditary nonpolyposis colorectal neoplasms Pathogenic:1
Likely pathogenic, criteria provided, single submitterclinical testingLabcorp Genetics (formerly Invitae), LabcorpAug 20, 2023In summary, the currently available evidence indicates that the variant is pathogenic, but additional data are needed to prove that conclusively. Therefore, this variant has been classified as Likely Pathogenic. ClinVar contains an entry for this variant (Variation ID: 455540). This variant has not been reported in the literature in individuals affected with MSH2-related conditions. This variant is not present in population databases (gnomAD no frequency). This variant results in the deletion of part of exon 1 of the MSH2 gene. It is expected to disrupt RNA splicing. Variants that disrupt the donor or acceptor splice site typically lead to a loss of protein function (PMID: 16199547), and loss-of-function variants in MSH2 are known to be pathogenic (PMID: 15849733, 24362816). -
Hereditary cancer-predisposing syndrome Pathogenic:1
Likely pathogenic, criteria provided, single submitterclinical testingAmbry GeneticsNov 22, 2024The c.207_211+42del47 variant results from a deletion of 47 nucleotides between positions c.207 and c.211+42 and involves the canonical splice donor site after coding exon 1 of the MSH2 gene. This variant has been identified in probands whose Lynch syndrome-associated tumor demonstrated loss of MSH2/MSH6 expression by immunohistochemistry and/or high microsatellite instability (Li S et al. J. Med. Genet. 2020 Jan;57:62-69; Ambry internal data). This variant is considered to be rare based on population cohorts in the Genome Aggregation Database (gnomAD). The canonical splice donor site is well conserved in available vertebrate species. In silico splice site analysis predicts that this alteration will weaken the native splice donor site and will and will result in the creation or strengthening of a novel splice donor site; however, direct evidence is insufficient at this time (Ambry internal data). Alterations that disrupt the canonical splice site are expected to cause aberrant splicing, resulting in an abnormal protein or a transcript that is subject to nonsense-mediated mRNA decay. As such, this alteration is classified as likely pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1553348901; hg19: chr2-47630530; API