rs1553353114

Variant names:

• chr2-47416311-ACCACTGGCTCTCAGTCTCTGGCTGCCTTGCTGAATAAGTGTAAAAC-A
• rs1553353114
• NM_000251.3:c.961_1006delACTGGCTCTCAGTCTCTGGCTGCCTTGCTGAATAAGTGTAAAACCC

Variant summary

Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1 PM2 PP5_Very_Strong

The NM_000251.3(MSH2):​c.961_1006delACTGGCTCTCAGTCTCTGGCTGCCTTGCTGAATAAGTGTAAAACCC​(p.Thr321LeufsTer21) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: MSH2 NM_000251.3 frameshift
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:2
• Conservation: PhyloP100: 4.97

Genes affected

MSH2 (HGNC:7325): (mutS homolog 2) This locus is frequently mutated in hereditary nonpolyposis colon cancer (HNPCC). When cloned, it was discovered to be a human homolog of the E. coli mismatch repair gene mutS, consistent with the characteristic alterations in microsatellite sequences (RER+ phenotype) found in HNPCC. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]

ACMG classification

Verdict is Pathogenic. Variant got 18 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 2-47416311-ACCACTGGCTCTCAGTCTCTGGCTGCCTTGCTGAATAAGTGTAAAAC-A is Pathogenic according to our data. Variant chr2-47416311-ACCACTGGCTCTCAGTCTCTGGCTGCCTTGCTGAATAAGTGTAAAAC-A is described in ClinVar as [Likely_pathogenic]. Clinvar id is 439197.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MSH2	NM_000251.3	c.961_1006delACTGGCTCTCAGTCTCTGGCTGCCTTGCTGAATAAGTGTAAAACCC	p.Thr321LeufsTer21	frameshift_variant	Exon 6 of 16	ENST00000233146.7	NP_000242.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MSH2	ENST00000233146.7	c.961_1006delACTGGCTCTCAGTCTCTGGCTGCCTTGCTGAATAAGTGTAAAACCC	p.Thr321LeufsTer21	frameshift_variant	Exon 6 of 16	1	NM_000251.3	ENSP00000233146.2

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic/Likely pathogenic

Submissions summary: Pathogenic:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not provided Pathogenic:1

May 05, 2017

Quest Diagnostics Nichols Institute San Juan Capistrano

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Hereditary nonpolyposis colorectal neoplasms Pathogenic:1

Nov 14, 2018

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

For these reasons, this variant has been classified as Pathogenic. Loss-of-function variants in MSH2 are known to be pathogenic (PMID: 15849733, 24362816). This variant has not been reported in the literature in individuals with MSH2-related disease. ClinVar contains an entry for this variant (Variation ID: 439197). This variant is not present in population databases (ExAC no frequency). This sequence change creates a premature translational stop signal (p.Thr321Leufs*21) in the MSH2 gene. It is expected to result in an absent or disrupted protein product. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1553353114; hg19: chr2-47643450;