rs1553380382

Variant names:

• chr2-29920362-T-TGAGCAGCGGGGCGCAGTCCAGAGCTAGC
• rs1553380382
• NM_004304.5:c.270_297dupGCTAGCTCTGGACTGCGCCCCGCTGCTC

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_004304.5(ALK):​c.270_297dupGCTAGCTCTGGACTGCGCCCCGCTGCTC​(p.Arg100AlafsTer135) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. L99L) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 33)
• Consequence: ALK NM_004304.5 frameshift
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: -0.942
• Publications: 0 publications found

Genes affected

ALK (HGNC:427): (ALK receptor tyrosine kinase) This gene encodes a receptor tyrosine kinase, which belongs to the insulin receptor superfamily. This protein comprises an extracellular domain, an hydrophobic stretch corresponding to a single pass transmembrane region, and an intracellular kinase domain. It plays an important role in the development of the brain and exerts its effects on specific neurons in the nervous system. This gene has been found to be rearranged, mutated, or amplified in a series of tumours including anaplastic large cell lymphomas, neuroblastoma, and non-small cell lung cancer. The chromosomal rearrangements are the most common genetic alterations in this gene, which result in creation of multiple fusion genes in tumourigenesis, including ALK (chromosome 2)/EML4 (chromosome 2), ALK/RANBP2 (chromosome 2), ALK/ATIC (chromosome 2), ALK/TFG (chromosome 3), ALK/NPM1 (chromosome 5), ALK/SQSTM1 (chromosome 5), ALK/KIF5B (chromosome 10), ALK/CLTC (chromosome 17), ALK/TPM4 (chromosome 19), and ALK/MSN (chromosome X).[provided by RefSeq, Jan 2011]

ALK Gene-Disease associations (from GenCC):

• neuroblastoma, susceptibility to, 3

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), ClinGen, G2P

ENSG00000233862 (HGNC:):

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_004304.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ALK	NM_004304.5	MANE Select	c.270_297dupGCTAGCTCTGGACTGCGCCCCGCTGCTC	p.Arg100AlafsTer135	frameshift	Exon 1 of 29	NP_004295.2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ALK	ENST00000389048.8	TSL:1 MANE Select	c.270_297dupGCTAGCTCTGGACTGCGCCCCGCTGCTC	p.Arg100AlafsTer135	frameshift	Exon 1 of 29	ENSP00000373700.3	Q9UM73
	ENSG00000233862	ENST00000669284.1		n.157+34859_157+34886dupGCTAGCTCTGGACTGCGCCCCGCTGCTC		intron	N/A
	ENSG00000233862	ENST00000769926.1		n.534+5829_534+5856dupGCTAGCTCTGGACTGCGCCCCGCTGCTC		intron	N/A

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome Cov.: 31

GnomAD4 genome Cov.: 33

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	Neuroblastoma, susceptibility to, 3 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		-0.94

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1553380382; hg19: chr2-30143228;