rs1553380382

Variant names:

• chr2-29920362-T-TGAGCAGCGGGGCGCAGTCCAGAGCTAGC
• rs1553380382
• NM_004304.5:c.270_297dupGCTAGCTCTGGACTGCGCCCCGCTGCTC

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2

The NM_004304.5(ALK):​c.270_297dupGCTAGCTCTGGACTGCGCCCCGCTGCTC​(p.Arg100AlafsTer135) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 33)
• Consequence: ALK NM_004304.5 frameshift
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: -0.942

Genes affected

ALK (HGNC:427): (ALK receptor tyrosine kinase) This gene encodes a receptor tyrosine kinase, which belongs to the insulin receptor superfamily. This protein comprises an extracellular domain, an hydrophobic stretch corresponding to a single pass transmembrane region, and an intracellular kinase domain. It plays an important role in the development of the brain and exerts its effects on specific neurons in the nervous system. This gene has been found to be rearranged, mutated, or amplified in a series of tumours including anaplastic large cell lymphomas, neuroblastoma, and non-small cell lung cancer. The chromosomal rearrangements are the most common genetic alterations in this gene, which result in creation of multiple fusion genes in tumourigenesis, including ALK (chromosome 2)/EML4 (chromosome 2), ALK/RANBP2 (chromosome 2), ALK/ATIC (chromosome 2), ALK/TFG (chromosome 3), ALK/NPM1 (chromosome 5), ALK/SQSTM1 (chromosome 5), ALK/KIF5B (chromosome 10), ALK/CLTC (chromosome 17), ALK/TPM4 (chromosome 19), and ALK/MSN (chromosome X).[provided by RefSeq, Jan 2011]

ENSG00000288553 (HGNC:):

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ALK	NM_004304.5	c.270_297dupGCTAGCTCTGGACTGCGCCCCGCTGCTC	p.Arg100AlafsTer135	frameshift_variant	Exon 1 of 29	ENST00000389048.8	NP_004295.2
ALK	XR_001738688.3	n.1197_1224dupGCTAGCTCTGGACTGCGCCCCGCTGCTC		non_coding_transcript_exon_variant	Exon 1 of 18

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ALK	ENST00000389048.8	c.270_297dupGCTAGCTCTGGACTGCGCCCCGCTGCTC	p.Arg100AlafsTer135	frameshift_variant	Exon 1 of 29	1	NM_004304.5	ENSP00000373700.3
ENSG00000288553	ENST00000669284.1	n.157+34859_157+34886dupGCTAGCTCTGGACTGCGCCCCGCTGCTC		intron_variant	Intron 1 of 1

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome Cov.: 31

GnomAD4 genome Cov.: 33

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Neuroblastoma, susceptibility to, 3 Uncertain:1

Jun 21, 2017

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change creates a premature translational stop signal (p.Arg100Alafs*135) in the ALK gene. It is expected to result in an absent or disrupted protein product. While this variant is not present in population databases, the frequency information is unreliable, as metrics indicate poor data quality at this position in the ExAC database. This variant has not been reported in the literature in individuals with ALK-related disease. The current clinical and genetic evidence is not sufficient to establish whether loss-of-function variants in ALK cause disease. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1553380382; hg19: chr2-30143228;