rs1553380382

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2

The NM_004304.5(ALK):​c.270_297dupGCTAGCTCTGGACTGCGCCCCGCTGCTC​(p.Arg100fs) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★). Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 33)

Consequence

ALK
NM_004304.5 frameshift

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, single submitter U:1

Conservation

PhyloP100: -0.942
Variant links:
Genes affected
ALK (HGNC:427): (ALK receptor tyrosine kinase) This gene encodes a receptor tyrosine kinase, which belongs to the insulin receptor superfamily. This protein comprises an extracellular domain, an hydrophobic stretch corresponding to a single pass transmembrane region, and an intracellular kinase domain. It plays an important role in the development of the brain and exerts its effects on specific neurons in the nervous system. This gene has been found to be rearranged, mutated, or amplified in a series of tumours including anaplastic large cell lymphomas, neuroblastoma, and non-small cell lung cancer. The chromosomal rearrangements are the most common genetic alterations in this gene, which result in creation of multiple fusion genes in tumourigenesis, including ALK (chromosome 2)/EML4 (chromosome 2), ALK/RANBP2 (chromosome 2), ALK/ATIC (chromosome 2), ALK/TFG (chromosome 3), ALK/NPM1 (chromosome 5), ALK/SQSTM1 (chromosome 5), ALK/KIF5B (chromosome 10), ALK/CLTC (chromosome 17), ALK/TPM4 (chromosome 19), and ALK/MSN (chromosome X).[provided by RefSeq, Jan 2011]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Uncertain_significance. Variant got 2 ACMG points.

PM2
Very rare variant in population databases, with high coverage;

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect #exon/exons MANE Protein UniProt
ALKNM_004304.5 linkuse as main transcriptc.270_297dupGCTAGCTCTGGACTGCGCCCCGCTGCTC p.Arg100fs frameshift_variant 1/29 ENST00000389048.8 NP_004295.2 Q9UM73B6D4Y2
ALKXR_001738688.3 linkuse as main transcriptn.1197_1224dupGCTAGCTCTGGACTGCGCCCCGCTGCTC non_coding_transcript_exon_variant 1/18

Ensembl

Gene Transcript HGVSc HGVSp Effect #exon/exons TSL MANE Protein Appris UniProt
ALKENST00000389048.8 linkuse as main transcriptc.270_297dupGCTAGCTCTGGACTGCGCCCCGCTGCTC p.Arg100fs frameshift_variant 1/291 NM_004304.5 ENSP00000373700.3 Q9UM73
ENSG00000288553ENST00000669284.1 linkuse as main transcriptn.157+34859_157+34886dupGCTAGCTCTGGACTGCGCCCCGCTGCTC intron_variant

Frequencies

GnomAD3 genomes
Cov.:
33
GnomAD4 exome
Cov.:
31
GnomAD4 genome
Cov.:
33

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Neuroblastoma, susceptibility to, 3 Uncertain:1
Uncertain significance, criteria provided, single submitterclinical testingLabcorp Genetics (formerly Invitae), LabcorpJun 21, 2017In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. The current clinical and genetic evidence is not sufficient to establish whether loss-of-function variants in ALK cause disease. This variant has not been reported in the literature in individuals with ALK-related disease. While this variant is not present in population databases, the frequency information is unreliable, as metrics indicate poor data quality at this position in the ExAC database. This sequence change creates a premature translational stop signal (p.Arg100Alafs*135) in the ALK gene. It is expected to result in an absent or disrupted protein product. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1553380382; hg19: chr2-30143228; API