rs1553380382
Variant summary
Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.
The NM_004304.5(ALK):c.270_297dupGCTAGCTCTGGACTGCGCCCCGCTGCTC(p.Arg100AlafsTer135) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. L99L) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_004304.5 frameshift
Scores
Clinical Significance
Conservation
Publications
- neuroblastoma, susceptibility to, 3Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), ClinGen, G2P
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 0 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_004304.5. You can select a different transcript below to see updated ACMG assignments.
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| ALK | TSL:1 MANE Select | c.270_297dupGCTAGCTCTGGACTGCGCCCCGCTGCTC | p.Arg100AlafsTer135 | frameshift | Exon 1 of 29 | ENSP00000373700.3 | Q9UM73 | ||
| ENSG00000233862 | n.157+34859_157+34886dupGCTAGCTCTGGACTGCGCCCCGCTGCTC | intron | N/A | ||||||
| ENSG00000233862 | n.534+5829_534+5856dupGCTAGCTCTGGACTGCGCCCCGCTGCTC | intron | N/A |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 exome Cov.: 31
GnomAD4 genome Cov.: 33
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at