rs1553416787

Variant names:

• chr2-70943670-TGTGCAGCGTGAACGGGCCCCTGGTG-T
• rs1553416787
• NM_001692.4:c.136_160delAGCGTGAACGGGCCCCTGGTGGTGC

Variant summary

Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1 PM2 PP5_Very_Strong

The NM_001692.4(ATP6V1B1):​c.136_160delAGCGTGAACGGGCCCCTGGTGGTGC​(p.Ser46TrpfsTer110) variant causes a frameshift change. The variant allele was found at a frequency of 0.00000137 in 1,461,666 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Likely pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. S46S) has been classified as Benign. Variant results in nonsense mediated mRNA decay.

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0000014 (0 hom.)
• Consequence: ATP6V1B1 NM_001692.4 frameshift
• Clinical Significance: Likely pathogenic criteria provided, multiple submitters, no conflicts P:2
• Conservation: PhyloP100: 5.65

Genes affected

ATP6V1B1 (HGNC:853): (ATPase H+ transporting V1 subunit B1) This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c'', and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This encoded protein is one of two V1 domain B subunit isoforms and is found in the kidney. Mutations in this gene cause distal renal tubular acidosis associated with sensorineural deafness. [provided by RefSeq, Jul 2008]

ENSG00000258881 (HGNC:):

VAX2 (HGNC:12661): (ventral anterior homeobox 2) This gene encodes a homeobox protein and is almost exclusively expressed in the ventral portion of the retina during development. In mouse studies, this gene was found to be required for the correct formation of the optic fissure and other aspects of retinal development. [provided by RefSeq, Sep 2008]

ATP6V1B1-AS1 (HGNC:51118): (ATP6V1B1 antisense RNA 1)

ACMG classification

Verdict is Pathogenic. Variant got 18 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 2-70943670-TGTGCAGCGTGAACGGGCCCCTGGTG-T is Pathogenic according to our data. Variant chr2-70943670-TGTGCAGCGTGAACGGGCCCCTGGTG-T is described in ClinVar as [Likely_pathogenic]. Clinvar id is 1677023.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ATP6V1B1	NM_001692.4	c.136_160delAGCGTGAACGGGCCCCTGGTGGTGC	p.Ser46TrpfsTer110	frameshift_variant	Exon 2 of 14	ENST00000234396.10	NP_001683.2
ATP6V1B1-AS1	NR_110273.1	n.524-1262_524-1238delCACCAGGGGCCCGTTCACGCTGCAC		intron_variant	Intron 2 of 2
ATP6V1B1-AS1	NR_110274.1	n.386-1262_386-1238delCACCAGGGGCCCGTTCACGCTGCAC		intron_variant	Intron 1 of 1
ATP6V1B1	XM_011532907.3	c.-265_-241delGTGCAGCGTGAACGGGCCCCTGGTG		upstream_gene_variant			XP_011531209.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ATP6V1B1	ENST00000234396.10	c.136_160delAGCGTGAACGGGCCCCTGGTGGTGC	p.Ser46TrpfsTer110	frameshift_variant	Exon 2 of 14	1	NM_001692.4	ENSP00000234396.4
ENSG00000258881	ENST00000606025.5	c.476-1262_476-1238delCACCAGGGGCCCGTTCACGCTGCAC		intron_variant	Intron 5 of 5	5		ENSP00000475641.1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome AF: 0.00000137 AC: 2 AN: 1461666 Hom.: 0 AF XY: 0.00000275 AC XY: 2 AN XY: 727148

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.0000232

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 32

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Renal tubular acidosis with progressive nerve deafness Pathogenic:2

Feb 04, 2022

Fulgent Genetics, Fulgent Genetics

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Mar 01, 2022

Women's Health and Genetics/Laboratory Corporation of America, LabCorp

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Variant summary: ATP6V1B1 c.136_160del25 (p.Ser46TrpfsX110) results in a premature termination codon, predicted to cause a truncation of the encoded protein or absence of the protein due to nonsense mediated decay, which are commonly known mechanisms for disease. Truncations downstream of this position have not been observed at our laboratory but have been reported in association with Renal tubular acidosis and sensorineural deafness in the HGMD and LOVD databases. The variant was absent in 250942 control chromosomes. To our knowledge, no occurrence of c.136_160del25 in individuals affected with Renal Tubular Acidosis With Progressive Nerve Deafness and no experimental evidence demonstrating its impact on protein function have been reported. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar after 2014. Based on the evidence outlined above, the variant was classified as likely pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1553416787; hg19: chr2-71170800;