rs1553479603

Variant names:

• chr2-178528523-CTTACTGGCAGGTTGTTTTTAAACCATTCGA-C
• rs1553479603
• NM_001267550.2:c.107198_107223+4delTCGAATGGTTTAAAAACAACCTGCCAGTAA

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_001267550.2(TTN):​c.107198_107223+4delTCGAATGGTTTAAAAACAACCTGCCAGTAA​(p.Ile35733fs) variant causes a frameshift, splice donor, splice region, intron change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00000187 in 1,601,458 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. I35733I) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency:
  • Genomes: 𝑓 0.0000066 (0 hom., cov: 33)
  • Exomes 𝑓: 0.0000014 (0 hom.)
• Consequence: TTN NM_001267550.2 frameshift, splice_donor, splice_region, intron
• Clinical Significance: Likely pathogenic criteria provided, multiple submitters, no conflicts P:4
• Conservation: PhyloP100: 8.72
• Publications: 0 publications found

Genes affected

TTN (HGNC:12403): (titin) This gene encodes a large abundant protein of striated muscle. The product of this gene is divided into two regions, a N-terminal I-band and a C-terminal A-band. The I-band, which is the elastic part of the molecule, contains two regions of tandem immunoglobulin domains on either side of a PEVK region that is rich in proline, glutamate, valine and lysine. The A-band, which is thought to act as a protein-ruler, contains a mixture of immunoglobulin and fibronectin repeats, and possesses kinase activity. An N-terminal Z-disc region and a C-terminal M-line region bind to the Z-line and M-line of the sarcomere, respectively, so that a single titin molecule spans half the length of a sarcomere. Titin also contains binding sites for muscle associated proteins so it serves as an adhesion template for the assembly of contractile machinery in muscle cells. It has also been identified as a structural protein for chromosomes. Alternative splicing of this gene results in multiple transcript variants. Considerable variability exists in the I-band, the M-line and the Z-disc regions of titin. Variability in the I-band region contributes to the differences in elasticity of different titin isoforms and, therefore, to the differences in elasticity of different muscle types. Mutations in this gene are associated with familial hypertrophic cardiomyopathy 9, and autoantibodies to titin are produced in patients with the autoimmune disease scleroderma. [provided by RefSeq, Feb 2012]

TTN-AS1 (HGNC:44124): (TTN antisense RNA 1) This gene encodes a non-coding RNA transcribed from the opposite strand to the titin gene. [provided by RefSeq, Aug 2016]

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 2-178528523-CTTACTGGCAGGTTGTTTTTAAACCATTCGA-C is Pathogenic according to our data. Variant chr2-178528523-CTTACTGGCAGGTTGTTTTTAAACCATTCGA-C is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 505097.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001267550.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TTN	NM_001267550.2	MANE Select	c.107198_107223+4delTCGAATGGTTTAAAAACAACCTGCCAGTAA	p.Ile35733fs	frameshift splice_donor splice_region intron	Exon 360 of 363	NP_001254479.2	Q8WZ42-12
	TTN	NM_001256850.1		c.102275_102300+4delTCGAATGGTTTAAAAACAACCTGCCAGTAA	p.Ile34092fs	frameshift splice_donor splice_region intron	Exon 310 of 313	NP_001243779.1	Q8WZ42-1
	TTN	NM_133378.4		c.99494_99519+4delTCGAATGGTTTAAAAACAACCTGCCAGTAA	p.Ile33165fs	frameshift splice_donor splice_region intron	Exon 309 of 312	NP_596869.4	Q8WZ42-11

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TTN	ENST00000589042.5	TSL:5 MANE Select	c.107198_107223+4delTCGAATGGTTTAAAAACAACCTGCCAGTAA	p.Ile35733fs	frameshift splice_donor splice_region intron	Exon 360 of 363	ENSP00000467141.1	Q8WZ42-12
	TTN	ENST00000446966.2	TSL:1	c.107042_107067+4delTCGAATGGTTTAAAAACAACCTGCCAGTAA	p.Ile35681fs	frameshift splice_donor splice_region intron	Exon 358 of 361	ENSP00000408004.2	A0A1B0GXE3
	TTN	ENST00000436599.2	TSL:1	c.106922_106947+4delTCGAATGGTTTAAAAACAACCTGCCAGTAA	p.Ile35641fs	frameshift splice_donor splice_region intron	Exon 358 of 361	ENSP00000405517.2	A0A0C4DG59

Frequencies

GnomAD3 genomes AF: 0.00000657 AC: 1 AN: 152188 Hom.: 0 Cov.: 33

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000147

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.00000138 AC: 2 AN: 1449270 Hom.: 0 AF XY: 0.00000139 AC XY: 1 AN XY: 719512

African (AFR) AF: 0.00 AC: 0 AN: 32854

American (AMR) AF: 0.00 AC: 0 AN: 43332

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 25624

East Asian (EAS) AF: 0.00 AC: 0 AN: 39478

South Asian (SAS) AF: 0.00 AC: 0 AN: 84698

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 52930

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5702

European-Non Finnish (NFE) AF: 0.00000181 AC: 2 AN: 1104836

Other (OTH) AF: 0.00 AC: 0 AN: 59816

GnomAD4 genome AF: 0.00000657 AC: 1 AN: 152188 Hom.: 0 Cov.: 33 AF XY: 0.0000135 AC XY: 1 AN XY: 74348

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 41448

American (AMR) AF: 0.00 AC: 0 AN: 15278

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3468

East Asian (EAS) AF: 0.00 AC: 0 AN: 5204

South Asian (SAS) AF: 0.00 AC: 0 AN: 4834

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10612

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.0000147 AC: 1 AN: 68024

Other (OTH) AF: 0.00 AC: 0 AN: 2092

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5. (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.00000378

ClinVar

ClinVar submissions

Significance: Likely pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
1	-	-	Autosomal recessive limb-girdle muscular dystrophy type 2J;C1858763:Dilated cardiomyopathy 1G (1)
1	-	-	Cardiovascular phenotype (1)
1	-	-	Dilated cardiomyopathy 1G (1)
1	-	-	Primary dilated cardiomyopathy (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		8.7

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.

Other links and lift over

dbSNP: rs1553479603;

hg19: chr2-179393250;