chr2-178528523-CTTACTGGCAGGTTGTTTTTAAACCATTCGA-C
Variant summary
Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1PM2PP5_Very_Strong
The NM_001267550.2(TTN):c.107198_107223+4delTCGAATGGTTTAAAAACAACCTGCCAGTAA(p.Ile35733fs) variant causes a frameshift, splice donor, splice region, intron change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00000187 in 1,601,458 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Likely pathogenic (★★). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_001267550.2 frameshift, splice_donor, splice_region, intron
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Pathogenic. Variant got 18 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
TTN | NM_001267550.2 | c.107198_107223+4delTCGAATGGTTTAAAAACAACCTGCCAGTAA | p.Ile35733fs | frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant | Exon 360 of 363 | ENST00000589042.5 | NP_001254479.2 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
TTN | ENST00000589042.5 | c.107198_107223+4delTCGAATGGTTTAAAAACAACCTGCCAGTAA | p.Ile35733fs | frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant | Exon 360 of 363 | 5 | NM_001267550.2 | ENSP00000467141.1 |
Frequencies
GnomAD3 genomes AF: 0.00000657 AC: 1AN: 152188Hom.: 0 Cov.: 33
GnomAD4 exome AF: 0.00000138 AC: 2AN: 1449270Hom.: 0 AF XY: 0.00000139 AC XY: 1AN XY: 719512
GnomAD4 genome AF: 0.00000657 AC: 1AN: 152188Hom.: 0 Cov.: 33 AF XY: 0.0000135 AC XY: 1AN XY: 74348
ClinVar
Submissions by phenotype
Autosomal recessive limb-girdle muscular dystrophy type 2J;C1858763:Dilated cardiomyopathy 1G Pathogenic:1
This variant results in the deletion of part of exon 360 (c.107198_107223+4del) of the TTN gene. It is expected to disrupt RNA splicing and likely results in a truncated or disrupted TTN protein. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with TTN-related conditions. ClinVar contains an entry for this variant (Variation ID: 505097). This variant is located in the M band of TTN (PMID: 25589632). Truncating variants in this region have been previously reported in individuals affected with autosomal recessive myopathy and muscular dystrophy (PMID: 18948003, 23975875, 24395473). Truncating variants in this region have also been identified in individuals affected with autosomal dominant dilated cardiomyopathy and/or cardio-related conditions (PMID: 27869827, 32964742, Invitae internal data). In summary, the currently available evidence indicates that the variant is pathogenic, but additional data are needed to prove that conclusively. Therefore, this variant has been classified as Likely Pathogenic. -
Primary dilated cardiomyopathy Pathogenic:1
The c.99494_99519+4del variant in TTN has been identified in a child with DCM (LMM data). It has also been identified in 0.0003% (3/1172860) of European chromosomes in gnomAD (http://gnomad.broadinstitute.org, v4.0.0). This variant is a 30 base-pair deletion that spans the canonical +1 and +2 positions in the 5' splice site consensus sequence of intron 309 and is therefore expected to disrupt splicing and lead to a truncated or absent protein. TTN truncating variants encoded in constitutive exons (PSI >95%) have been found to be significantly associated with DCM regardless of their position in titin (Roberts 2015 PMID:25589632, Schafer 2017 PMID:27869827). The c.99494_99519+4del variant is located in such a highly expressed exon in the M band. In summary, although additional studies are required to fully establish its clinical significance, this variant meets criteria to be classified as likely pathogenic for autosomal dominant DCM. ACMG/AMP Criteria applied: PVS1_Strong, PM2_Supporting. -
Cardiovascular phenotype Pathogenic:1
The c.80003_80028+4del30 variant results from a deletion of 30 nucleotides between positions c.80003 and c.80028+4 and involves the canonical splice donor site after coding exon 187 of the TTN gene. This exon is located in the M-band region of the N2-B isoform of the titin protein and is constitutively expressed in TTN transcripts (percent spliced in or PSI 100%). This variant is considered to be rare based on population cohorts in the Genome Aggregation Database (gnomAD). The canonical splice donor site is highly conserved in available vertebrate species. In silico splice site analysis predicts that this alteration will weaken the native splice donor site. This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. While truncating variants in TTN are present in 1-3% of the general population, truncating variants in the M-band have been reported in association with autosomal recessive titinopathies, primarily presenting with skeletal myopathy phenotypes (Ceyhan-Birsoy O et al. Neurology. 2013 Oct 1;81(14):1205-14; De Cid R et al. Neurology. 2015;85(24):2126-35). In addition, regardless of their position, TTN truncating variants encoded in constitutive exons (PSI >90%) have been found to be significantly associated with dilated cardiomyopathy (DCM), though truncating variants in the A-band are the most common cause of DCM (Herman DS et al. N. Engl. J. Med., 2012 Feb;366:619-28; Roberts AM et al. Sci Transl Med, 2015 Jan;7:270ra6; Schafer S et al. Nat. Genet., 2017 01;49:46-53). Based on the majority of available evidence to date, this variant is likely to be pathogenic in association with autosomal recessive titinopathy; however, the clinical significance of this alteration with respect to cardiomyopathy remains unclear. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at