rs1553608221
- chr2-197706085-GGGGCAACCCTCAGGCGATCACCCCCGAACCATTTCATCACGTAGTTCTTCAGTGGCTGGACGAGGAGCTGCCCGACCTGTCCGTGTCTCGCAGAAGTAGCCACTTGCACTGGGGCATTCCGGTGCCCGGGGATGATTCGCAGACCATCTATGTATGGCTGGATGCCCTGGTCAACTACCTCACTGTAATTGGCTACCCAAATGCTGAGTTCAAATCTTGGTGGCCGGCCACCTCTCATATCATAGGTAAGGACATTCTCAAATTCCAT-G
- rs1553608221
- NM_138395.4:c.682_949del
Variant summary
Our verdict is Uncertain significance. The variant received 5 ACMG points: 5P and 0B. PVS1_StrongPP5
The NM_138395.4(MARS2):c.682_949del(p.Gly228ProfsTer9) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars).
Frequency
Consequence
NM_138395.4 frameshift
Scores
Clinical Significance
Conservation
Publications
- mitochondrial diseaseInheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
- spastic ataxia 3Inheritance: AR Classification: MODERATE, SUPPORTIVE, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, Genomics England PanelApp
- combined oxidative phosphorylation defect type 25Inheritance: Unknown, AR Classification: SUPPORTIVE, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 5 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_138395.4. You can select a different transcript below to see updated ACMG assignments.
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MARS2 | TSL:6 MANE Select | c.682_949del | p.Gly228ProfsTer9 | frameshift | Exon 1 of 1 | ENSP00000282276.6 | Q96GW9 | ||
| ENSG00000222017 | TSL:1 | n.166+7223_166+7490del | intron | N/A | |||||
| ENSG00000222017 | n.213+65586_214-65503del | intron | N/A |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 genome Cov.: 33
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at