rs1553665683

Variant names:

• chr3-37050540-G-GTCTATAAAGCCTTGCGCTCACACATTCTGCC
• rs1553665683
• NM_000249.4:c.2161_2191dupTATAAAGCCTTGCGCTCACACATTCTGCCTC

Variant summary

Our verdict is Pathogenic. Variant got 14 ACMG points: 14P and 0B. PVS1_Strong PM2 PP5_Very_Strong

The NM_000249.4(MLH1):​c.2161_2191dupTATAAAGCCTTGCGCTCACACATTCTGCCTC​(p.Pro731LeufsTer2) variant causes a frameshift, stop gained change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: MLH1 NM_000249.4 frameshift, stop_gained
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:2
• Conservation: PhyloP100: 7.83

Genes affected

MLH1 (HGNC:7127): (mutL homolog 1) The protein encoded by this gene can heterodimerize with mismatch repair endonuclease PMS2 to form MutL alpha, part of the DNA mismatch repair system. When MutL alpha is bound by MutS beta and some accessory proteins, the PMS2 subunit of MutL alpha introduces a single-strand break near DNA mismatches, providing an entry point for exonuclease degradation. The encoded protein is also involved in DNA damage signaling and can heterodimerize with DNA mismatch repair protein MLH3 to form MutL gamma, which is involved in meiosis. This gene was identified as a locus frequently mutated in hereditary nonpolyposis colon cancer (HNPCC). [provided by RefSeq, Aug 2017]

ACMG classification

Verdict is Pathogenic. Variant got 14 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. There are 9 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 3-37050540-G-GTCTATAAAGCCTTGCGCTCACACATTCTGCC is Pathogenic according to our data. Variant chr3-37050540-G-GTCTATAAAGCCTTGCGCTCACACATTCTGCC is described in ClinVar as [Pathogenic]. Clinvar id is 455421.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MLH1	NM_000249.4	c.2161_2191dupTATAAAGCCTTGCGCTCACACATTCTGCCTC	p.Pro731LeufsTer2	frameshift_variant, stop_gained	Exon 19 of 19	ENST00000231790.8	NP_000240.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MLH1	ENST00000231790.8	c.2161_2191dupTATAAAGCCTTGCGCTCACACATTCTGCCTC	p.Pro731LeufsTer2	frameshift_variant, stop_gained	Exon 19 of 19	1	NM_000249.4	ENSP00000231790.3

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 31

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Colorectal cancer, hereditary nonpolyposis, type 2 Pathogenic:1

Jul 25, 2023

Myriad Genetics, Inc.

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant is considered pathogenic. This variant creates a frameshift predicted to result in premature protein truncation. -

Hereditary nonpolyposis colorectal neoplasms Pathogenic:1

Jan 04, 2018

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Loss-of-function variants in MLH1 are known to be pathogenic (PMID: 15713769, 24362816). For these reasons, this variant has been classified as Pathogenic. This truncation affects the highly conserved C-terminal domain responsible for MLH1 constitutive dimerization with PMS2 (PMID: 12799449, 16338176, 20533529). Different truncating variants downstream of this variant (including p.Lys732* and p.Tyr750*) have been reported in individuals affected with Lynch syndrome and have been determined to be pathogenic (PMID: 10923051, 25197397, 10422993, Invitae). This suggests that disruption of this region of the MLH1 protein is causative of disease. This variant has not been reported in the literature in individuals with MLH1-related disease. ClinVar contains an entry for this variant (Variation ID: 455421). This variant is not present in population databases (ExAC no frequency). This sequence change results in a premature translational stop signal in the MLH1 gene (p.Pro731Leufs*2). While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 26 amino acids of the MLH1 protein. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1553665683; hg19: chr3-37092031;