rs1553665683
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_000249.4(MLH1):c.2161_2191dupTATAAAGCCTTGCGCTCACACATTCTGCCTC(p.Pro731LeufsTer2) variant causes a frameshift, stop gained change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. P731P) has been classified as Likely benign. The gene MLH1 is included in the ClinGen Criteria Specification Registry.
Frequency
Consequence
NM_000249.4 frameshift, stop_gained
Scores
Clinical Significance
Conservation
Publications
- Lynch syndromeInheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, G2P, Orphanet
- Lynch syndrome 2Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Genomics England PanelApp
- Muir-Torre syndromeInheritance: AD Classification: DEFINITIVE, STRONG, MODERATE, SUPPORTIVE Submitted by: Genomics England PanelApp, G2P, Orphanet, Ambry Genetics
- mismatch repair cancer syndrome 1Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), G2P, Orphanet, ClinGen
- Lynch syndrome 1Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
- ovarian cancerInheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
- malignant pancreatic neoplasmInheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
- rhabdomyosarcomaInheritance: AR Classification: MODERATE Submitted by: Genomics England PanelApp
- prostate cancerInheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
- breast cancerInheritance: AD Classification: NO_KNOWN Submitted by: Ambry Genetics
- hereditary breast carcinomaInheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000249.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MLH1 | MANE Select | c.2161_2191dupTATAAAGCCTTGCGCTCACACATTCTGCCTC | p.Pro731LeufsTer2 | frameshift stop_gained | Exon 19 of 19 | NP_000240.1 | P40692-1 | ||
| MLH1 | c.2068_2098dupTATAAAGCCTTGCGCTCACACATTCTGCCTC | p.Pro700LeufsTer2 | frameshift stop_gained | Exon 18 of 18 | NP_001341557.1 | A0A087WX20 | |||
| MLH1 | c.2062_2092dupTATAAAGCCTTGCGCTCACACATTCTGCCTC | p.Pro698LeufsTer2 | frameshift stop_gained | Exon 18 of 18 | NP_001341558.1 | A0AAQ5BGZ2 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MLH1 | TSL:1 MANE Select | c.2161_2191dupTATAAAGCCTTGCGCTCACACATTCTGCCTC | p.Pro731LeufsTer2 | frameshift stop_gained | Exon 19 of 19 | ENSP00000231790.3 | P40692-1 | ||
| MLH1 | TSL:1 | c.1954_1984dupTATAAAGCCTTGCGCTCACACATTCTGCCTC | p.Pro662LeufsTer2 | frameshift stop_gained | Exon 17 of 17 | ENSP00000416687.3 | H0Y818 | ||
| MLH1 | TSL:1 | c.1725_1755dupTATAAAGCCTTGCGCTCACACATTCTGCCTC | p.Leu586TyrfsTer37 | frameshift | Exon 15 of 15 | ENSP00000416476.2 | H0Y806 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 exome Cov.: 31
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.