rs1553676221

Positions:

• chr2-227094121-TTACCACTTGATCCTGGGAGGCCCTGCAGGCCTGGTGCTCCAGGCAAGCCAGG-T

Variant summary

Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1 PM2 PP5_Very_Strong

The NM_000092.5(COL4A4):​c.1321_1369+3delCCTGGCTTGCCTGGAGCACCAGGCCTGCAGGGCCTCCCAGGATCAAGTGGTA​(p.Pro441fs) variant causes a frameshift, splice donor, splice region, intron change. The variant allele was found at a frequency of 0.00000205 in 1,461,082 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Likely pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. P441P) has been classified as Benign. Variant results in nonsense mediated mRNA decay.

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0000021 (0 hom.)
• Consequence: COL4A4 NM_000092.5 frameshift, splice_donor, splice_region, intron
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:8
• Conservation: PhyloP100: 5.89

Genes affected

COL4A4 (HGNC:2206): (collagen type IV alpha 4 chain) This gene encodes one of the six subunits of type IV collagen, the major structural component of basement membranes. This particular collagen IV subunit, however, is only found in a subset of basement membranes. Like the other members of the type IV collagen gene family, this gene is organized in a head-to-head conformation with another type IV collagen gene so that each gene pair shares a common promoter. Mutations in this gene are associated with type II autosomal recessive Alport syndrome (hereditary glomerulonephropathy) and with familial benign hematuria (thin basement membrane disease). Two transcripts, differing only in their transcription start sites, have been identified for this gene and, as is common for collagen genes, multiple polyadenylation sites are found in the 3' UTR. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Pathogenic. Variant got 18 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 2-227094121-TTACCACTTGATCCTGGGAGGCCCTGCAGGCCTGGTGCTCCAGGCAAGCCAGG-T is Pathogenic according to our data. Variant chr2-227094121-TTACCACTTGATCCTGGGAGGCCCTGCAGGCCTGGTGCTCCAGGCAAGCCAGG-T is described in ClinVar as [Likely_pathogenic]. Clinvar id is 242441.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars. Variant chr2-227094121-TTACCACTTGATCCTGGGAGGCCCTGCAGGCCTGGTGCTCCAGGCAAGCCAGG-T is described in Lovd as [Pathogenic].

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
COL4A4	NM_000092.5	c.1321_1369+3delCCTGGCTTGCCTGGAGCACCAGGCCTGCAGGGCCTCCCAGGATCAAGTGGTA	p.Pro441fs	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	20/48	ENST00000396625.5	NP_000083.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
COL4A4	ENST00000396625.5	c.1321_1369+3delCCTGGCTTGCCTGGAGCACCAGGCCTGCAGGGCCTCCCAGGATCAAGTGGTA	p.Pro441fs	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	20/48	5	NM_000092.5	ENSP00000379866.3

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome AF: 0.00000205 AC: 3 AN: 1461082 Hom.: 0 AF XY: 0.00000275 AC XY: 2 AN XY: 726896

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000270

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic/Likely pathogenic

Submissions summary: Pathogenic:8

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Autosomal recessive Alport syndrome Pathogenic:2

Pathogenic, criteria provided, single submitter	clinical testing	Laboratory for Molecular Genetics, Institute of Pathology, Faculty of Medicine, University of Ljubljana	Nov 18, 2020	- -
Pathogenic, criteria provided, single submitter	clinical testing	Institute of Human Genetics Munich, Klinikum Rechts Der Isar, TU München	Jun 07, 2019	- -

Autosomal dominant Alport syndrome Pathogenic:2

Pathogenic, no assertion criteria provided	clinical testing	Bioscientia Institut fuer Medizinische Diagnostik GmbH, Sonic Healthcare	Sep 18, 2017	- -
Pathogenic, no assertion criteria provided	clinical testing	Bioscientia Institut fuer Medizinische Diagnostik GmbH, Sonic Healthcare	Sep 13, 2018	- -

Autosomal recessive Alport syndrome;CN376803:Hematuria, benign familial, 1 Pathogenic:1

Likely pathogenic, criteria provided, single submitter

clinical testing

Fulgent Genetics, Fulgent Genetics

Feb 19, 2024

- -

not provided Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Jul 08, 2023

For these reasons, this variant has been classified as Pathogenic. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may disrupt the consensus splice site. ClinVar contains an entry for this variant (Variation ID: 242441). This variant has been observed in individual(s) with Alport syndrome (Invitae). It has also been observed to segregate with disease in related individuals. This variant is not present in population databases (gnomAD no frequency). This variant results in the deletion of part of exon 20 (c.1321_1369+3del) of the COL4A4 gene. It is expected to disrupt RNA splicing. Variants that disrupt the donor or acceptor splice site typically lead to a loss of protein function (PMID: 16199547), and loss-of-function variants in COL4A4 are known to be pathogenic (PMID: 21196518, 24854265, 25307543). -

Benign familial hematuria Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

Laboratory of Medical Genetics, National & Kapodistrian University of Athens

Oct 27, 2022

PVS1, PM2, PP4, PP5 -

Alport syndrome Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

Victorian Clinical Genetics Services, Murdoch Childrens Research Institute

Jul 17, 2023

Based on the classification scheme VCGS_Germline_v1.3.4, this variant is classified as Pathogenic. Following criteria are met: 0102 - Loss of function is a known mechanism of disease for this gene and is associated with Alport syndrome (MONDO:0018965). Dominant negative is a suspected mechanism of disease for this gene as it is a structural protein (PMIDs: 12028435, 24046192). (I) 0108 - This gene is associated with both recessive and dominant disease. Alport syndrome typically has biallelic inheritance, although rare cases of monoallelic inheritance have been reported (PMID: 28704582). Thin basement membrane nephropathy (TBMN) and focal segmental glomerulosclerosis (FSGS) are associated with autosomal dominant inheritance (OMIM, PMIDs: 16467446, 17942953). (I) 0211 - Canonical splice site variant without proven consequence on splicing (no functional evidence available). This variant is a deletion of 52bp that encompasses part of exon 20 and the cannonical donor splice site of intron 20. (SP) 0251 - This variant is heterozygous. (I) 0301 - Variant is absent from gnomAD (both v2 and v3). (SP) 0801 - This variant has strong previous evidence of pathogenicity in unrelated individuals. This variant has been observed in over five unrelated individuals, including in one heterozygous individual with TBMN and her two compound heterozygous affected children (PMIDs: 33233744, 26934356). (SP) 1007 - No published functional evidence has been identified for this variant. (I) 1206 - This variant has been shown to be paternally inherited. (I) Legend: (SP) - Supporting pathogenic, (I) - Information, (SB) - Supporting benign -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1553676221; hg19: chr2-227958837;