rs1553676221

Variant names:

• chr2-227094121-TTACCACTTGATCCTGGGAGGCCCTGCAGGCCTGGTGCTCCAGGCAAGCCAGG-T
• rs1553676221
• NM_000092.5:c.1321_1369+3delCCTGGCTTGCCTGGAGCACCAGGCCTGCAGGGCCTCCCAGGATCAAGTGGTA

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_000092.5(COL4A4):​c.1321_1369+3delCCTGGCTTGCCTGGAGCACCAGGCCTGCAGGGCCTCCCAGGATCAAGTGGTA​(p.Pro441fs) variant causes a frameshift, splice donor, splice region, intron change. The variant allele was found at a frequency of 0.00000205 in 1,461,082 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. P441P) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0000021 (0 hom.)
• Consequence: COL4A4 NM_000092.5 frameshift, splice_donor, splice_region, intron
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:8
• Conservation: PhyloP100: 5.89
• Publications: 3 publications found

Genes affected

COL4A4 (HGNC:2206): (collagen type IV alpha 4 chain) This gene encodes one of the six subunits of type IV collagen, the major structural component of basement membranes. This particular collagen IV subunit, however, is only found in a subset of basement membranes. Like the other members of the type IV collagen gene family, this gene is organized in a head-to-head conformation with another type IV collagen gene so that each gene pair shares a common promoter. Mutations in this gene are associated with type II autosomal recessive Alport syndrome (hereditary glomerulonephropathy) and with familial benign hematuria (thin basement membrane disease). Two transcripts, differing only in their transcription start sites, have been identified for this gene and, as is common for collagen genes, multiple polyadenylation sites are found in the 3' UTR. [provided by RefSeq, Jul 2008]

COL4A4 Gene-Disease associations (from GenCC):

• autosomal recessive Alport syndrome

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp, G2P, Orphanet, Ambry Genetics, Myriad Women’s Health
• Alport syndrome

  Inheritance: SD Classification: DEFINITIVE Submitted by: ClinGen
• hematuria, benign familial, 1

  Inheritance: AD Classification: STRONG, MODERATE Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp, Ambry Genetics
• autosomal dominant Alport syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 2-227094121-TTACCACTTGATCCTGGGAGGCCCTGCAGGCCTGGTGCTCCAGGCAAGCCAGG-T is Pathogenic according to our data. Variant chr2-227094121-TTACCACTTGATCCTGGGAGGCCCTGCAGGCCTGGTGCTCCAGGCAAGCCAGG-T is described in ClinVar as Pathogenic/Likely_pathogenic. ClinVar VariationId is 242441.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000092.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	COL4A4	NM_000092.5	MANE Select	c.1321_1369+3delCCTGGCTTGCCTGGAGCACCAGGCCTGCAGGGCCTCCCAGGATCAAGTGGTA	p.Pro441fs	frameshift splice_donor splice_region intron	Exon 20 of 48	NP_000083.3

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	COL4A4	ENST00000396625.5	TSL:5 MANE Select	c.1321_1369+3delCCTGGCTTGCCTGGAGCACCAGGCCTGCAGGGCCTCCCAGGATCAAGTGGTA	p.Pro441fs	frameshift splice_donor splice_region intron	Exon 20 of 48	ENSP00000379866.3

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome AF: 0.00000205 AC: 3 AN: 1461082 Hom.: 0 AF XY: 0.00000275 AC XY: 2 AN XY: 726896

African (AFR) AF: 0.00 AC: 0 AN: 33452

American (AMR) AF: 0.00 AC: 0 AN: 44678

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26108

East Asian (EAS) AF: 0.00 AC: 0 AN: 39694

South Asian (SAS) AF: 0.00 AC: 0 AN: 86154

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53368

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5748

European-Non Finnish (NFE) AF: 0.00000270 AC: 3 AN: 1111524

Other (OTH) AF: 0.00 AC: 0 AN: 60356

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions as Germline

Significance: Pathogenic/Likely pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
2	-	-	Autosomal dominant Alport syndrome (2)
2	-	-	Autosomal recessive Alport syndrome (2)
1	-	-	Alport syndrome (1)
1	-	-	Autosomal recessive Alport syndrome;CN376803:Hematuria, benign familial, 1 (1)
1	-	-	Benign familial hematuria (1)
1	-	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		5.9
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1553676221; hg19: chr2-227958837;