rs1553692107

Positions:

• chr2-178609768-G-GGTACTCTTTCCCCTCTTCAAGTCCTTTTGCT

Variant summary

Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1 PM2 PP5_Very_Strong

The NM_001267550.2(TTN):​c.51654_51655insAGCAAAAGGACTTGAAGAGGGGAAAGAGTAC​(p.Gln17219SerfsTer5) variant causes a stop gained, frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: TTN NM_001267550.2 stop_gained, frameshift
• Clinical Significance: Likely pathogenic criteria provided, multiple submitters, no conflicts P:4
• Conservation: PhyloP100: 2.97

Genes affected

TTN (HGNC:12403): (titin) This gene encodes a large abundant protein of striated muscle. The product of this gene is divided into two regions, a N-terminal I-band and a C-terminal A-band. The I-band, which is the elastic part of the molecule, contains two regions of tandem immunoglobulin domains on either side of a PEVK region that is rich in proline, glutamate, valine and lysine. The A-band, which is thought to act as a protein-ruler, contains a mixture of immunoglobulin and fibronectin repeats, and possesses kinase activity. An N-terminal Z-disc region and a C-terminal M-line region bind to the Z-line and M-line of the sarcomere, respectively, so that a single titin molecule spans half the length of a sarcomere. Titin also contains binding sites for muscle associated proteins so it serves as an adhesion template for the assembly of contractile machinery in muscle cells. It has also been identified as a structural protein for chromosomes. Alternative splicing of this gene results in multiple transcript variants. Considerable variability exists in the I-band, the M-line and the Z-disc regions of titin. Variability in the I-band region contributes to the differences in elasticity of different titin isoforms and, therefore, to the differences in elasticity of different muscle types. Mutations in this gene are associated with familial hypertrophic cardiomyopathy 9, and autoantibodies to titin are produced in patients with the autoimmune disease scleroderma. [provided by RefSeq, Feb 2012]

TTN-AS1 (HGNC:44124): (TTN antisense RNA 1) This gene encodes a non-coding RNA transcribed from the opposite strand to the titin gene. [provided by RefSeq, Aug 2016]

ACMG classification

Verdict is Pathogenic. Variant got 18 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 2-178609768-G-GGTACTCTTTCCCCTCTTCAAGTCCTTTTGCT is Pathogenic according to our data. Variant chr2-178609768-G-GGTACTCTTTCCCCTCTTCAAGTCCTTTTGCT is described in ClinVar as [Likely_pathogenic]. Clinvar id is 466635.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	UniProt
TTN	NM_001267550.2	c.51654_51655insAGCAAAAGGACTTGAAGAGGGGAAAGAGTAC	p.Gln17219SerfsTer5	stop_gained, frameshift_variant	272/363	ENST00000589042.5

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Appris	UniProt
TTN	ENST00000589042.5	c.51654_51655insAGCAAAAGGACTTGAAGAGGGGAAAGAGTAC	p.Gln17219SerfsTer5	stop_gained, frameshift_variant	272/363	5	NM_001267550.2	P1
TTN-AS1	ENST00000659121.1	n.502+12091_502+12121dup		intron_variant, non_coding_transcript_variant

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 32

GnomAD4 genome Cov.: 32

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:4

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Autosomal recessive limb-girdle muscular dystrophy type 2J;C1858763:Dilated cardiomyopathy 1G Pathogenic:1

Likely pathogenic, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Mar 26, 2023

This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.Gln17219Serfs*5) in the TTN gene. While this is not anticipated to result in nonsense mediated decay, it is expected to create a truncated TTN protein. This variant has not been reported in the literature in individuals affected with TTN-related conditions. In summary, the currently available evidence indicates that the variant is pathogenic, but additional data are needed to prove that conclusively. Therefore, this variant has been classified as Likely Pathogenic. This variant is located in the A band of TTN (PMID: 25589632). Truncating variants in this region are significantly overrepresented in patients affected with dilated cardiomyopathy (PMID: 25589632). Truncating variants in this region have also been reported in individuals affected with autosomal recessive centronuclear myopathy (PMID: 23975875). ClinVar contains an entry for this variant (Variation ID: 466635). -

Dilated cardiomyopathy 1G Pathogenic:1

Likely pathogenic, criteria provided, single submitter

clinical testing

Genomic Medicine Lab, University of California San Francisco

Apr 06, 2023

- -

not provided Pathogenic:1

Likely pathogenic, criteria provided, single submitter

clinical testing

GeneDx

Jan 10, 2020

Has not been previously published as pathogenic or benign to our knowledge; Reported in ClinVar as a likely pathogenic variant (ClinVar Variant ID# 466635; Landrum et al., 2016); Not observed in large population cohorts (Lek et al., 2016); Frameshift variant predicted to result in protein truncation or nonsense mediated decay in a gene for which loss-of-function is a known mechanism of disease; Located in the A-band region of titin, where the majority of truncating pathogenic variants associated with DCM have been reported (Herman et al., 2012) -

Cardiovascular phenotype Pathogenic:1

Likely pathogenic, criteria provided, single submitter

clinical testing

Ambry Genetics

Apr 13, 2020

The c.24429_24459dup31 variant, located in coding exon 99 of the TTN gene, results from a duplication of AGCAAAAGGACTTGAAGAGGGGAAAGAGTAC at nucleotide position 24429, causing a translational frameshift with a predicted alternate stop codon (p.Q8154Sfs*5). This exon is located in the A-band region of the N2-B isoform of the titin protein and is constitutively expressed in TTN transcripts (percent spliced in or PSI 100%). This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. While truncating variants in TTN are present in 1-3% of the general population, truncating variants in the A-band are the most common cause of dilated cardiomyopathy (DCM) (Herman DS et al. N. Engl. J. Med., 2012 Feb;366:619-28; Roberts AM et al. Sci Transl Med, 2015 Jan;7:270ra6). TTN truncating variants encoded in constitutive exons (PSI >90%) have been found to be significantly associated with DCM regardless of their position in titin (Schafer S et al. Nat. Genet., 2017 01;49:46-53). As such, this alteration is classified as likely pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1553692107; hg19: chr2-179474495;