rs1553692107
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_001267550.2(TTN):c.51624_51654dupAGCAAAAGGACTTGAAGAGGGGAAAGAGTAC(p.Gln17219SerfsTer5) variant causes a frameshift, stop gained change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_001267550.2 frameshift, stop_gained
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| TTN | NM_001267550.2 | c.51624_51654dupAGCAAAAGGACTTGAAGAGGGGAAAGAGTAC | p.Gln17219SerfsTer5 | frameshift_variant, stop_gained | Exon 272 of 363 | ENST00000589042.5 | NP_001254479.2 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| TTN | ENST00000589042.5 | c.51624_51654dupAGCAAAAGGACTTGAAGAGGGGAAAGAGTAC | p.Gln17219SerfsTer5 | frameshift_variant, stop_gained | Exon 272 of 363 | 5 | NM_001267550.2 | ENSP00000467141.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 exome Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Autosomal recessive limb-girdle muscular dystrophy type 2J;C1858763:Dilated cardiomyopathy 1G Pathogenic:1
ClinVar contains an entry for this variant (Variation ID: 466635). This sequence change creates a premature translational stop signal (p.Gln17219Serfs*5) in the TTN gene. While this is not anticipated to result in nonsense mediated decay, it is expected to create a truncated TTN protein. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with TTN-related conditions. This variant is located in the A band of TTN (PMID: 25589632). Truncating variants in this region are significantly overrepresented in patients affected with dilated cardiomyopathy (PMID: 25589632). Truncating variants in this region have also been reported in individuals affected with autosomal recessive centronuclear myopathy (PMID: 23975875). In summary, the currently available evidence indicates that the variant is pathogenic, but additional data are needed to prove that conclusively. Therefore, this variant has been classified as Likely Pathogenic. -
Dilated cardiomyopathy 1G Pathogenic:1
- -
not provided Pathogenic:1
Has not been previously published as pathogenic or benign to our knowledge; Reported in ClinVar as a likely pathogenic variant (ClinVar Variant ID# 466635; Landrum et al., 2016); Not observed in large population cohorts (Lek et al., 2016); Frameshift variant predicted to result in protein truncation or nonsense mediated decay in a gene for which loss-of-function is a known mechanism of disease; Located in the A-band region of titin, where the majority of truncating pathogenic variants associated with DCM have been reported (Herman et al., 2012) -
Cardiovascular phenotype Pathogenic:1
The c.24429_24459dup31 variant, located in coding exon 99 of the TTN gene, results from a duplication of AGCAAAAGGACTTGAAGAGGGGAAAGAGTAC at nucleotide position 24429, causing a translational frameshift with a predicted alternate stop codon (p.Q8154Sfs*5). This exon is located in the A-band region of the N2-B isoform of the titin protein and is constitutively expressed in TTN transcripts (percent spliced in or PSI 100%). This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. While truncating variants in TTN are present in 1-3% of the general population, truncating variants in the A-band are the most common cause of dilated cardiomyopathy (DCM) (Herman DS et al. N. Engl. J. Med., 2012 Feb;366:619-28; Roberts AM et al. Sci Transl Med, 2015 Jan;7:270ra6). TTN truncating variants encoded in constitutive exons (PSI >90%) have been found to be significantly associated with DCM regardless of their position in titin (Schafer S et al. Nat. Genet., 2017 01;49:46-53). As such, this alteration is classified as likely pathogenic. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at