rs1553713075

Variant names:

• chr3-50302170-GCACATACATCTGTGACTTCCCTGTGCCCTCCAGCAC-CGGGCCACACGGAA
• rs1553713075
• NM_033159.4:c.751_787delGTGCTGGAGGGCACAGGGAAGTCACAGATGTATGTGCinsTTCCGTGTGGCCCG

Variant summary

Our verdict is Uncertain significance. The variant received 5 ACMG points: 5P and 0B. PVS1_Strong PP5

The NM_153285.3(HYAL1):​c.-26-1_10delGTGCTGGAGGGCACAGGGAAGTCACAGATGTATGTGCinsTTCCGTGTGGCCCG variant causes a splice acceptor, 5 prime UTR, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars).

• Frequency: Genomes: not found (cov: 32)
• Consequence: HYAL1 NM_153285.3 splice_acceptor, 5_prime_UTR, intron
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 8.82
• Publications: 1 publications found

Genes affected

HYAL1 (HGNC:5320): (hyaluronidase 1) This gene encodes a lysosomal hyaluronidase. Hyaluronidases intracellularly degrade hyaluronan, one of the major glycosaminoglycans of the extracellular matrix. Hyaluronan is thought to be involved in cell proliferation, migration and differentiation. This enzyme is active at an acidic pH and is the major hyaluronidase in plasma. Mutations in this gene are associated with mucopolysaccharidosis type IX, or hyaluronidase deficiency. The gene is one of several related genes in a region of chromosome 3p21.3 associated with tumor suppression. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

HYAL1 Gene-Disease associations (from GenCC):

• mucopolysaccharidosis type 9

  Inheritance: AR Classification: DEFINITIVE, STRONG, MODERATE, SUPPORTIVE, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), ClinGen, G2P, Genomics England PanelApp, Ambry Genetics, Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 5 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.28060263 fraction of the gene. Cryptic splice site detected, with MaxEntScore 4.8, offset of 6, new splice context is: agccgtgccctctatcccAGcat. Cryptic site results in inframe change. If cryptic site found is not functional and variant results in exon loss, it results in frameshift change.
• PP5: Variant 3-50302170-GCACATACATCTGTGACTTCCCTGTGCCCTCCAGCAC-CGGGCCACACGGAA is Pathogenic according to our data. Variant chr3-50302170-GCACATACATCTGTGACTTCCCTGTGCCCTCCAGCAC-CGGGCCACACGGAA is described in ClinVar as Pathogenic. ClinVar VariationId is 3531.Status of the report is no_assertion_criteria_provided, 0 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_153285.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	HYAL1	NM_033159.4	MANE Select	c.751_787delGTGCTGGAGGGCACAGGGAAGTCACAGATGTATGTGCinsTTCCGTGTGGCCCG	p.Val251PhefsTer20	frameshift missense	Exon 2 of 4	NP_149349.2
	HYAL1	NM_153281.2		c.751_787delGTGCTGGAGGGCACAGGGAAGTCACAGATGTATGTGCinsTTCCGTGTGGCCCG	p.Val251PhefsTer20	frameshift missense	Exon 4 of 6	NP_695013.1	Q12794-1
	HYAL1	NM_153282.3		c.751_787delGTGCTGGAGGGCACAGGGAAGTCACAGATGTATGTGCinsTTCCGTGTGGCCCG	p.Val251PhefsTer20	frameshift missense	Exon 2 of 3	NP_695014.1	Q12794-2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	HYAL1	ENST00000395144.7	TSL:1 MANE Select	c.751_787delGTGCTGGAGGGCACAGGGAAGTCACAGATGTATGTGCinsTTCCGTGTGGCCCG	p.Val251PhefsTer20	frameshift missense	Exon 2 of 4	ENSP00000378576.2	Q12794-1
	HYAL1	ENST00000266031.8	TSL:1	c.751_787delGTGCTGGAGGGCACAGGGAAGTCACAGATGTATGTGCinsTTCCGTGTGGCCCG	p.Val251PhefsTer20	frameshift missense	Exon 1 of 3	ENSP00000266031.4	Q12794-1
	HYAL1	ENST00000395143.6	TSL:1	c.751_787delGTGCTGGAGGGCACAGGGAAGTCACAGATGTATGTGCinsTTCCGTGTGGCCCG	p.Val251PhefsTer20	frameshift missense	Exon 2 of 3	ENSP00000378575.2	Q12794-2

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: no assertion criteria provided

Pathogenic	VUS	Benign	Condition
1	-	-	Deficiency of hyaluronoglucosaminidase (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		8.8

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1553713075; hg19: chr3-50339601;