rs1553891755

Variant names:

• chr4-54727443-GTTGTTGAGGAGATAAATGGAAACAATTATGTTTACATAGACCCAACACAAC-G
• rs1553891755
• NM_000222.3:c.1678_1728delGTTGAGGAGATAAATGGAAACAATTATGTTTACATAGACCCAACACAACTT

Variant summary

Our verdict is Uncertain significance. The variant received 5 ACMG points: 5P and 0B. PM1 PM4 PP3

The NM_001385284.1(KIT):​c.1681_1731delGTTGAGGAGATAAATGGAAACAATTATGTTTACATAGACCCAACACAACTT​(p.Val561_Leu577del) variant causes a conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: KIT NM_001385284.1 conservative_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 9.56
• Publications: 1 publications found

Genes affected

KIT (HGNC:6342): (KIT proto-oncogene, receptor tyrosine kinase) This gene encodes a receptor tyrosine kinase. This gene was initially identified as a homolog of the feline sarcoma viral oncogene v-kit and is often referred to as proto-oncogene c-Kit. The canonical form of this glycosylated transmembrane protein has an N-terminal extracellular region with five immunoglobulin-like domains, a transmembrane region, and an intracellular tyrosine kinase domain at the C-terminus. Upon activation by its cytokine ligand, stem cell factor (SCF), this protein phosphorylates multiple intracellular proteins that play a role in in the proliferation, differentiation, migration and apoptosis of many cell types and thereby plays an important role in hematopoiesis, stem cell maintenance, gametogenesis, melanogenesis, and in mast cell development, migration and function. This protein can be a membrane-bound or soluble protein. Mutations in this gene are associated with gastrointestinal stromal tumors, mast cell disease, acute myelogenous leukemia, and piebaldism. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2020]

KIT Gene-Disease associations (from GenCC):

• gastrointestinal stromal tumor

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Orphanet, ClinGen, Ambry Genetics
• piebaldism

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: PanelApp Australia, Ambry Genetics, G2P, Labcorp Genetics (formerly Invitae), Orphanet, Genomics England PanelApp
• cutaneous mastocytosis

  Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
• mastocytosis

  Inheritance: AD Classification: STRONG, MODERATE Submitted by: Genomics England PanelApp, Ambry Genetics

ACMG classification

Our verdict: Uncertain_significance. The variant received 5 ACMG points.

• PM1: In a hotspot region, there are 4 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 1 benign, 44 uncertain in NM_001385284.1
• PM4: Nonframeshift variant in NON repetitive region in NM_001385284.1.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001385284.1. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	KIT	NM_000222.3	MANE Select	c.1678_1728delGTTGAGGAGATAAATGGAAACAATTATGTTTACATAGACCCAACACAACTT	p.Val560_Leu576del	conservative_inframe_deletion	Exon 11 of 21	NP_000213.1
	KIT	NM_001385284.1		c.1681_1731delGTTGAGGAGATAAATGGAAACAATTATGTTTACATAGACCCAACACAACTT	p.Val561_Leu577del	conservative_inframe_deletion	Exon 11 of 21	NP_001372213.1
	KIT	NM_001385290.1		c.1681_1731delGTTGAGGAGATAAATGGAAACAATTATGTTTACATAGACCCAACACAACTT	p.Val561_Leu577del	conservative_inframe_deletion	Exon 11 of 21	NP_001372219.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	KIT	ENST00000288135.6	TSL:1 MANE Select	c.1678_1728delGTTGAGGAGATAAATGGAAACAATTATGTTTACATAGACCCAACACAACTT	p.Val560_Leu576del	conservative_inframe_deletion	Exon 11 of 21	ENSP00000288135.6
	KIT	ENST00000412167.7	TSL:1	c.1669_1719delGTTGAGGAGATAAATGGAAACAATTATGTTTACATAGACCCAACACAACTT	p.Val557_Leu573del	conservative_inframe_deletion	Exon 11 of 21	ENSP00000390987.3
	KIT	ENST00000687109.1		c.1681_1731delGTTGAGGAGATAAATGGAAACAATTATGTTTACATAGACCCAACACAACTT	p.Val561_Leu577del	conservative_inframe_deletion	Exon 11 of 21	ENSP00000509371.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions as Germline

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	Gastrointestinal stromal tumor (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.6

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1553891755; hg19: chr4-55593609; COSMIC: COSV55403300;