rs1553891755

Variant summary

Our verdict is Uncertain significance. The variant received 5 ACMG points: 5P and 0B. PM1PM4PP3

The NM_000222.3(KIT):​c.1678_1728delGTTGAGGAGATAAATGGAAACAATTATGTTTACATAGACCCAACACAACTT​(p.Val560_Leu576del) variant causes a conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

Frequency

Genomes: not found (cov: 32)

Consequence

KIT
NM_000222.3 conservative_inframe_deletion

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, single submitter U:1

Conservation

PhyloP100: 9.56

Publications

1 publications found
Variant links:
Genes affected
KIT (HGNC:6342): (KIT proto-oncogene, receptor tyrosine kinase) This gene encodes a receptor tyrosine kinase. This gene was initially identified as a homolog of the feline sarcoma viral oncogene v-kit and is often referred to as proto-oncogene c-Kit. The canonical form of this glycosylated transmembrane protein has an N-terminal extracellular region with five immunoglobulin-like domains, a transmembrane region, and an intracellular tyrosine kinase domain at the C-terminus. Upon activation by its cytokine ligand, stem cell factor (SCF), this protein phosphorylates multiple intracellular proteins that play a role in in the proliferation, differentiation, migration and apoptosis of many cell types and thereby plays an important role in hematopoiesis, stem cell maintenance, gametogenesis, melanogenesis, and in mast cell development, migration and function. This protein can be a membrane-bound or soluble protein. Mutations in this gene are associated with gastrointestinal stromal tumors, mast cell disease, acute myelogenous leukemia, and piebaldism. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2020]
KIT Gene-Disease associations (from GenCC):
  • gastrointestinal stromal tumor
    Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Orphanet, ClinGen, Ambry Genetics
  • piebaldism
    Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: PanelApp Australia, Ambry Genetics, G2P, Labcorp Genetics (formerly Invitae), Orphanet, Genomics England PanelApp
  • cutaneous mastocytosis
    Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
  • mastocytosis
    Inheritance: AD Classification: STRONG, MODERATE Submitted by: Genomics England PanelApp, Ambry Genetics

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Uncertain_significance. The variant received 5 ACMG points.

PM1
In a hotspot region, there are 4 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 1 benign, 42 uncertain in NM_000222.3
PM4
Nonframeshift variant in NON repetitive region in NM_000222.3.
PP3
No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
KITNM_000222.3 linkc.1678_1728delGTTGAGGAGATAAATGGAAACAATTATGTTTACATAGACCCAACACAACTT p.Val560_Leu576del conservative_inframe_deletion Exon 11 of 21 ENST00000288135.6 NP_000213.1 P10721-1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
KITENST00000288135.6 linkc.1678_1728delGTTGAGGAGATAAATGGAAACAATTATGTTTACATAGACCCAACACAACTT p.Val560_Leu576del conservative_inframe_deletion Exon 11 of 21 1 NM_000222.3 ENSP00000288135.6 P10721-1

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Gastrointestinal stromal tumor Uncertain:1
Dec 13, 2017
Molecular Diagnostics, Rajiv Gandhi Cancer Institute & Research Center
Significance:Uncertain significance
Review Status:criteria provided, single submitter
Collection Method:clinical testing

1. Reduced response to sunitinib & shorter progression free survival (PFS). CIViC:Evidence EID4597 & CIViC:Evidence EID4598. Reference:-Pubmed ID: 26772734 and Pubmed ID: 18955458. 2. Improved response & PFS to Regorafenib. CIViC:Evidence EID4599, CIViC:Evidence EID4601 & CIViC:Evidence EID4601. Reference: Pubmed ID:23177515; Pubmed ID:22614970 and Pubmed ID:27371698. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
9.6

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs1553891755; hg19: chr4-55593609; COSMIC: COSV55403300; API