rs1553891755

Variant names:

• chr4-54727443-GTTGTTGAGGAGATAAATGGAAACAATTATGTTTACATAGACCCAACACAAC-G
• rs1553891755
• NM_000222.3:c.1678_1728delGTTGAGGAGATAAATGGAAACAATTATGTTTACATAGACCCAACACAACTT

Variant summary

Our verdict is Uncertain significance. Variant got 5 ACMG points: 5P and 0B. PM2 PM4 PP3

The NM_000222.3(KIT):​c.1678_1728delGTTGAGGAGATAAATGGAAACAATTATGTTTACATAGACCCAACACAACTT​(p.Val560_Leu576del) variant causes a conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: KIT NM_000222.3 conservative_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 9.56

Genes affected

KIT (HGNC:6342): (KIT proto-oncogene, receptor tyrosine kinase) This gene encodes a receptor tyrosine kinase. This gene was initially identified as a homolog of the feline sarcoma viral oncogene v-kit and is often referred to as proto-oncogene c-Kit. The canonical form of this glycosylated transmembrane protein has an N-terminal extracellular region with five immunoglobulin-like domains, a transmembrane region, and an intracellular tyrosine kinase domain at the C-terminus. Upon activation by its cytokine ligand, stem cell factor (SCF), this protein phosphorylates multiple intracellular proteins that play a role in in the proliferation, differentiation, migration and apoptosis of many cell types and thereby plays an important role in hematopoiesis, stem cell maintenance, gametogenesis, melanogenesis, and in mast cell development, migration and function. This protein can be a membrane-bound or soluble protein. Mutations in this gene are associated with gastrointestinal stromal tumors, mast cell disease, acute myelogenous leukemia, and piebaldism. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2020]

ACMG classification

Verdict is Uncertain_significance. Variant got 5 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_000222.3.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
KIT	NM_000222.3	c.1678_1728delGTTGAGGAGATAAATGGAAACAATTATGTTTACATAGACCCAACACAACTT	p.Val560_Leu576del	conservative_inframe_deletion	Exon 11 of 21	ENST00000288135.6	NP_000213.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
KIT	ENST00000288135.6	c.1678_1728delGTTGAGGAGATAAATGGAAACAATTATGTTTACATAGACCCAACACAACTT	p.Val560_Leu576del	conservative_inframe_deletion	Exon 11 of 21	1	NM_000222.3	ENSP00000288135.6

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Gastrointestinal stromal tumor Uncertain:1

Dec 13, 2017

Molecular Diagnostics, Rajiv Gandhi Cancer Institute & Research Center

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

1. Reduced response to sunitinib & shorter progression free survival (PFS). CIViC:Evidence EID4597 & CIViC:Evidence EID4598. Reference:-Pubmed ID: 26772734 and Pubmed ID: 18955458. 2. Improved response & PFS to Regorafenib. CIViC:Evidence EID4599, CIViC:Evidence EID4601 & CIViC:Evidence EID4601. Reference: Pubmed ID:23177515; Pubmed ID:22614970 and Pubmed ID:27371698. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1553891755; hg19: chr4-55593609;