rs1554282803

Variant names:

• chr6-33320950-GATGAGCCGCTCAATGCGCCTGTTA-G
• rs1554282803
• NM_001141969.2:c.801_824delTAACAGGCGCATTGAGCGGCTCAT

Variant summary

Our verdict is Uncertain significance. The variant received 3 ACMG points: 3P and 0B. PM4 PP3

The NM_001141969.2(DAXX):​c.801_824delTAACAGGCGCATTGAGCGGCTCAT​(p.Asn268_Ile275del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as (no stars).

• Frequency: Genomes: not found (cov: 32)
• Consequence: DAXX NM_001141969.2 disruptive_inframe_deletion
• Clinical Significance: - - O:1
• Conservation: PhyloP100: 7.96
• Publications: 1 publications found

Genes affected

DAXX (HGNC:2681): (death domain associated protein) This gene encodes a multifunctional protein that resides in multiple locations in the nucleus and in the cytoplasm. It interacts with a wide variety of proteins, such as apoptosis antigen Fas, centromere protein C, and transcription factor erythroblastosis virus E26 oncogene homolog 1. In the nucleus, the encoded protein functions as a potent transcription repressor that binds to sumoylated transcription factors. Its repression can be relieved by the sequestration of this protein into promyelocytic leukemia nuclear bodies or nucleoli. This protein also associates with centromeres in G2 phase. In the cytoplasm, the encoded protein may function to regulate apoptosis. The subcellular localization and function of this protein are modulated by post-translational modifications, including sumoylation, phosphorylation and polyubiquitination. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2008]

ACMG classification

Our verdict: Uncertain_significance. The variant received 3 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_001141969.2.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
DAXX	NM_001141969.2	c.801_824delTAACAGGCGCATTGAGCGGCTCAT	p.Asn268_Ile275del	disruptive_inframe_deletion	Exon 3 of 8	ENST00000374542.10	NP_001135441.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
DAXX	ENST00000374542.10	c.801_824delTAACAGGCGCATTGAGCGGCTCAT	p.Asn268_Ile275del	disruptive_inframe_deletion	Exon 3 of 8	1	NM_001141969.2	ENSP00000363668.5

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: -

Submissions summary: Other:1

Revision: -

Submissions by phenotype

Neuroendocrine pancreatic tumor Other:1

Nov 13, 2024

Genome Sciences Centre, British Columbia Cancer Agency

Significance: -

Review Status: no assertion criteria provided

Collection Method: research

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		8.0

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1554282803; hg19: chr6-33288727; COSMIC: COSV56474448; COSMIC: COSV56474448;