rs1554544862

Variant names:

• chr8-41694002-CGGTGGAACTTCCGGCGCCGG-C
• rs1554544862
• NM_000037.4:c.3408_3427delCCGGCGCCGGAAGTTCCACC

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_000037.4(ANK1):​c.3408_3427delCCGGCGCCGGAAGTTCCACC​(p.Arg1137ProfsTer78) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: ANK1 NM_000037.4 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 9.31
• Publications: 0 publications found

Genes affected

ANK1 (HGNC:492): (ankyrin 1) Ankyrins are a family of proteins that link the integral membrane proteins to the underlying spectrin-actin cytoskeleton and play key roles in activities such as cell motility, activation, proliferation, contact and the maintenance of specialized membrane domains. Multiple isoforms of ankyrin with different affinities for various target proteins are expressed in a tissue-specific, developmentally regulated manner. Most ankyrins are typically composed of three structural domains: an amino-terminal domain containing multiple ankyrin repeats; a central region with a highly conserved spectrin binding domain; and a carboxy-terminal regulatory domain which is the least conserved and subject to variation. Ankyrin 1, the prototype of this family, was first discovered in the erythrocytes, but since has also been found in brain and muscles. Mutations in erythrocytic ankyrin 1 have been associated in approximately half of all patients with hereditary spherocytosis. Complex patterns of alternative splicing in the regulatory domain, giving rise to different isoforms of ankyrin 1 have been described. Truncated muscle-specific isoforms of ankyrin 1 resulting from usage of an alternate promoter have also been identified. [provided by RefSeq, Dec 2008]

ANK1 Gene-Disease associations (from GenCC):

• hereditary spherocytosis

  Inheritance: AR, AD Classification: DEFINITIVE, SUPPORTIVE, LIMITED Submitted by: ClinGen, Orphanet
• hereditary spherocytosis type 1

  Inheritance: AR, AD Classification: STRONG, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, Laboratory for Molecular Medicine

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 8-41694002-CGGTGGAACTTCCGGCGCCGG-C is Pathogenic according to our data. Variant chr8-41694002-CGGTGGAACTTCCGGCGCCGG-C is described in ClinVar as Pathogenic. ClinVar VariationId is 559408.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000037.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ANK1	NM_000037.4	MANE Select	c.3408_3427delCCGGCGCCGGAAGTTCCACC	p.Arg1137ProfsTer78	frameshift	Exon 29 of 43	NP_000028.3
	ANK1	NM_001142446.2		c.3531_3550delCCGGCGCCGGAAGTTCCACC	p.Arg1178ProfsTer78	frameshift	Exon 30 of 43	NP_001135918.1
	ANK1	NM_020476.3		c.3408_3427delCCGGCGCCGGAAGTTCCACC	p.Arg1137ProfsTer78	frameshift	Exon 29 of 42	NP_065209.2

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ANK1	ENST00000289734.13	TSL:1 MANE Select	c.3408_3427delCCGGCGCCGGAAGTTCCACC	p.Arg1137ProfsTer78	frameshift	Exon 29 of 43	ENSP00000289734.8
	ANK1	ENST00000265709.14	TSL:1	c.3531_3550delCCGGCGCCGGAAGTTCCACC	p.Arg1178ProfsTer78	frameshift	Exon 30 of 43	ENSP00000265709.8
	ANK1	ENST00000347528.8	TSL:1	c.3408_3427delCCGGCGCCGGAAGTTCCACC	p.Arg1137ProfsTer78	frameshift	Exon 29 of 42	ENSP00000339620.4

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Pathogenic:1

Apr 10, 2018

MVZ Dr. Eberhard & Partner Dortmund

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.3
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1554544862; hg19: chr8-41551520;