rs1554651411

Variant names:

• chr9-35658020-C-CGTCCTCAGCTTCACAGAGTA
• rs1554651411
• ENST00000363046.2:n.-2_-1insTACTCTGTGAAGCTGAGGAC

Your query was ambiguous. Multiple possible variants found:

• chr9-35658020-C-CGTCCTCAGCTTCACAGAGTA
• chr9-35658020-C-CGTCCTCAGCTTCACAGAGTAGT

Variant summary

Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PP5_Very_Strong

The ENST00000363046.2(RMRP):​n.-2_-1insTACTCTGTGAAGCTGAGGAC variant causes a upstream gene change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000074 in 689,116 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★).

• Frequency:
  • Genomes: 𝑓 0.000079 (0 hom., cov: 34)
  • Exomes 𝑓: 0.000073 (0 hom.)
• Consequence: RMRP ENST00000363046.2 upstream_gene
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:7
• Conservation: PhyloP100: -12.3
• Publications: 0 publications found

Genes affected

RMRP (HGNC:10031): (RNA component of mitochondrial RNA processing endoribonuclease) This gene encodes the RNA component of mitochondrial RNA processing endoribonuclease, which cleaves mitochondrial RNA at a priming site of mitochondrial DNA replication. This RNA also interacts with the telomerase reverse transcriptase catalytic subunit to form a distinct ribonucleoprotein complex that has RNA-dependent RNA polymerase activity and produces double-stranded RNAs that can be processed into small interfering RNA. Mutations in this gene are associated with cartilage-hair hypoplasia.[provided by RefSeq, Mar 2010]

RMRP Gene-Disease associations (from GenCC):

• cartilage-hair hypoplasia

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), ClinGen, Myriad Women’s Health, G2P

ACMG classification

Our verdict: Likely_pathogenic. The variant received 8 ACMG points.

• PP5: Variant 9-35658020-C-CGTCCTCAGCTTCACAGAGTA is Pathogenic according to our data. Variant chr9-35658020-C-CGTCCTCAGCTTCACAGAGTA is described in ClinVar as Pathogenic. ClinVar VariationId is 550387.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
RMRP	NR_003051.4	n.-2_-1insTACTCTGTGAAGCTGAGGAC		upstream_gene_variant		ENST00000363046.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
RMRP	ENST00000363046.2	n.-2_-1insTACTCTGTGAAGCTGAGGAC		upstream_gene_variant		6	NR_003051.4

Frequencies

GnomAD3 genomes AF: 0.0000789 AC: 12 AN: 152094 Hom.: 0 Cov.: 34

Gnomad AFR AF: 0.000241

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000294

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.0000628 AC: 8 AN: 127388 AF XY: 0.0000719

Gnomad AFR exome AF: 0.000165

Gnomad AMR exome AF: 0.0000840

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.000193

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000624

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.0000726 AC: 39 AN: 536904 Hom.: 0 Cov.: 0 AF XY: 0.0000726 AC XY: 21 AN XY: 289060

African (AFR) AF: 0.0000646 AC: 1 AN: 15486

American (AMR) AF: 0.0000584 AC: 2 AN: 34230

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 19712

East Asian (EAS) AF: 0.000315 AC: 10 AN: 31782

South Asian (SAS) AF: 0.0000161 AC: 1 AN: 62268

European-Finnish (FIN) AF: 0.0000605 AC: 2 AN: 33056

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 2398

European-Non Finnish (NFE) AF: 0.0000714 AC: 22 AN: 308116

Other (OTH) AF: 0.0000335 AC: 1 AN: 29856

GnomAD4 genome AF: 0.0000788 AC: 12 AN: 152212 Hom.: 0 Cov.: 34 AF XY: 0.0000537 AC XY: 4 AN XY: 74436

African (AFR) AF: 0.000241 AC: 10 AN: 41538

American (AMR) AF: 0.00 AC: 0 AN: 15284

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3472

East Asian (EAS) AF: 0.00 AC: 0 AN: 5176

South Asian (SAS) AF: 0.00 AC: 0 AN: 4832

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10610

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 294

European-Non Finnish (NFE) AF: 0.0000294 AC: 2 AN: 67982

Other (OTH) AF: 0.00 AC: 0 AN: 2112

Alfa AF: 0.000144 Hom.: 0

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:7

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Metaphyseal chondrodysplasia, McKusick type Pathogenic:5

-

Shenzhen Maternity and Child Healthcare Hospital, Institute of Maternal and Child Medicine Research

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: research

- -

Jan 20, 2017

Counsyl

Significance: Likely pathogenic

Review Status: no assertion criteria provided

Collection Method: clinical testing

This submission and the accompanying classification are no longer maintained by the submitter. For more information on current observations and classification, please contact variantquestions@myriad.com. -

Sep 29, 2020

Natera, Inc.

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: clinical testing

- -

Apr 05, 2021

Women's Health and Genetics/Laboratory Corporation of America, LabCorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Variant summary: RMRP n.-22_-3dup20 involves the duplication of 20 nucleotides in the promoter region of RMRP, which is located between the TATA box (-33 to -25) and the transcription initiation site. Other insertions or duplications in the promoter region of RMRP have been classified as pathogenic (internally and in ClinVar). The variant allele was found at a frequency of 5.7e-05 in 158744 control chromosomes (all heterozygotes). The variant has been reported in the literature in multiple individuals affected with Cartilage-Hair Hypoplasia (Harada_2005, Hermanns_2006, Turkkani-Asal_2009). These data indicate that the variant is likely to be associated with disease. At least one publication reports experimental evidence evaluating an impact on protein function, and demonstrated that the variant resulted in severely reduced RMRP transcription (Hermanns_2005). Two clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar after 2014, and classified the variant as pathogenic (n=1) / likely pathogenic (n=1). Based on the evidence outlined above, the variant was classified as pathogenic. -

Jan 25, 2024

Laboratorio de Biologia Molecular/Medicina Genomica - IFF/Fiocruz, Instituto Fernandes Figueira, Fundacao Oswaldo Cruz

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The variant n.-21_-2dupTACTCTGTGAAGCTGAGGAC was identified in a compound heterozygous state with another variant in the transcribed region of RMRP gene in an individual affected with Cartilage-Hair Hypoplasia. This alteration is located within the promoter region of the RMRP gene, which encodes an untranslated RNA. Segregation analysis showed that each of the unaffected parents was heterozygous for one of the two variants. Other insertions and duplications in this region have been reported in individuals affected with cartilage-hair hypoplasia-anauxetic dysplasia spectrum disorders (PMID: 11207361, 21956908, 21396580). This variant involves the duplication of 20 nucleotides between the TATA box and the transcription initiation site and functional studies have shown that this type of alteration result in reduced expression of the RMRP gene (PMIDs: 11207361, 16254002). For these reasons, this variant has been classified as Pathogenic. -

Anauxetic dysplasia Pathogenic:1

Dec 10, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant occurs in the RMRP gene, which encodes an RNA molecule that does not result in a protein product. This variant is present in population databases (no rsID available, gnomAD 0.02%). This variant has been observed in individual(s) with cartilage-hair hypoplasia (CHH) (PMID: 15780958, 16838329). In at least one individual the data is consistent with being in trans (on the opposite chromosome) from a pathogenic variant. This variant is also known as -4_-23dup, -5_-24dup, and -6_-25dup. ClinVar contains an entry for this variant (Variation ID: 550387). Algorithms developed to predict the effect of variants on gene product structure and function are not available or were not evaluated for this variant. Experimental studies have shown that this variant affects RMRP function (PMID: 16254002). For these reasons, this variant has been classified as Pathogenic. -

Metaphyseal chondrodysplasia, McKusick type;C1834821:Metaphyseal dysplasia without hypotrichosis;C4551965:Anauxetic dysplasia 1 Pathogenic:1

May 05, 2022

Fulgent Genetics, Fulgent Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		-12

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1554651411; hg19: chr9-35658017;