rs1554651411

Positions:

• chr9-35658020-C-CGTCCTCAGCTTCACAGAGTA
• chr9-35658020-C-CGTCCTCAGCTTCACAGAGTAGT

Variant summary

Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PM2 PP5_Very_Strong

The 9-35658020-C-CGTCCTCAGCTTCACAGAGTA variant causes a upstream gene change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000074 in 689,116 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Likely pathogenic (★★).

• Frequency:
  • Genomes: 𝑓 0.000079 (0 hom., cov: 34)
  • Exomes 𝑓: 0.000073 (0 hom.)
• Consequence: RMRP NR_003051.3 upstream_gene
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:7
• Conservation: PhyloP100: -12.3

Genes affected

RMRP (HGNC:10031): (RNA component of mitochondrial RNA processing endoribonuclease) This gene encodes the RNA component of mitochondrial RNA processing endoribonuclease, which cleaves mitochondrial RNA at a priming site of mitochondrial DNA replication. This RNA also interacts with the telomerase reverse transcriptase catalytic subunit to form a distinct ribonucleoprotein complex that has RNA-dependent RNA polymerase activity and produces double-stranded RNAs that can be processed into small interfering RNA. Mutations in this gene are associated with cartilage-hair hypoplasia.[provided by RefSeq, Mar 2010]

ACMG classification

Verdict is Pathogenic. Variant got 10 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 9-35658020-C-CGTCCTCAGCTTCACAGAGTA is Pathogenic according to our data. Variant chr9-35658020-C-CGTCCTCAGCTTCACAGAGTA is described in ClinVar as [Likely_pathogenic]. Clinvar id is 550387.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
RMRP	NR_003051.3			upstream_gene_variant

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
RMRP	ENST00000363046.1			upstream_gene_variant

Frequencies

GnomAD3 genomes AF: 0.0000789 AC: 12 AN: 152094 Hom.: 0 Cov.: 34

Gnomad AFR AF: 0.000241

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000294

Gnomad OTH AF: 0.00

GnomAD3 exomes AF: 0.0000628 AC: 8 AN: 127388 Hom.: 0 AF XY: 0.0000719 AC XY: 5 AN XY: 69588

Gnomad AFR exome AF: 0.000165

Gnomad AMR exome AF: 0.0000840

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.000193

Gnomad SAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000624

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.0000726 AC: 39 AN: 536904 Hom.: 0 Cov.: 0 AF XY: 0.0000726 AC XY: 21 AN XY: 289060

Gnomad4 AFR exome AF: 0.0000646

Gnomad4 AMR exome AF: 0.0000584

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.000315

Gnomad4 SAS exome AF: 0.0000161

Gnomad4 FIN exome AF: 0.0000605

Gnomad4 NFE exome AF: 0.0000714

Gnomad4 OTH exome AF: 0.0000335

GnomAD4 genome AF: 0.0000788 AC: 12 AN: 152212 Hom.: 0 Cov.: 34 AF XY: 0.0000537 AC XY: 4 AN XY: 74436

Gnomad4 AFR AF: 0.000241

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000294

Gnomad4 OTH AF: 0.00

Alfa AF: 0.000144 Hom.: 0

ClinVar

Significance: Pathogenic/Likely pathogenic

Submissions summary: Pathogenic:7

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Metaphyseal chondrodysplasia, McKusick type Pathogenic:5

Pathogenic, criteria provided, single submitter	research	Shenzhen Maternity and Child Healthcare Hospital, Institute of Maternal and Child Medicine Research	-	- -
Likely pathogenic, criteria provided, single submitter	clinical testing	Counsyl	Jan 20, 2017	- -
Pathogenic, criteria provided, single submitter	clinical testing	Laboratorio de Biologia Molecular/Medicina Genomica - IFF/Fiocruz, Instituto Fernandes Figueira, Fundacao Oswaldo Cruz	Jan 25, 2024	The variant n.-21_-2dupTACTCTGTGAAGCTGAGGAC was identified in a compound heterozygous state with another variant in the transcribed region of RMRP gene in an individual affected with Cartilage-Hair Hypoplasia. This alteration is located within the promoter region of the RMRP gene, which encodes an untranslated RNA. Segregation analysis showed that each of the unaffected parents was heterozygous for one of the two variants. Other insertions and duplications in this region have been reported in individuals affected with cartilage-hair hypoplasia-anauxetic dysplasia spectrum disorders (PMID: 11207361, 21956908, 21396580). This variant involves the duplication of 20 nucleotides between the TATA box and the transcription initiation site and functional studies have shown that this type of alteration result in reduced expression of the RMRP gene (PMIDs: 11207361, 16254002). For these reasons, this variant has been classified as Pathogenic. -
Pathogenic, criteria provided, single submitter	clinical testing	Women's Health and Genetics/Laboratory Corporation of America, LabCorp	Apr 05, 2021	Variant summary: RMRP n.-22_-3dup20 involves the duplication of 20 nucleotides in the promoter region of RMRP, which is located between the TATA box (-33 to -25) and the transcription initiation site. Other insertions or duplications in the promoter region of RMRP have been classified as pathogenic (internally and in ClinVar). The variant allele was found at a frequency of 5.7e-05 in 158744 control chromosomes (all heterozygotes). The variant has been reported in the literature in multiple individuals affected with Cartilage-Hair Hypoplasia (Harada_2005, Hermanns_2006, Turkkani-Asal_2009). These data indicate that the variant is likely to be associated with disease. At least one publication reports experimental evidence evaluating an impact on protein function, and demonstrated that the variant resulted in severely reduced RMRP transcription (Hermanns_2005). Two clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar after 2014, and classified the variant as pathogenic (n=1) / likely pathogenic (n=1). Based on the evidence outlined above, the variant was classified as pathogenic. -
Pathogenic, no assertion criteria provided	clinical testing	Natera, Inc.	Sep 29, 2020	- -

Anauxetic dysplasia Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Jan 27, 2024

This variant occurs in the RMRP gene, which encodes an RNA molecule that does not result in a protein product. This variant is present in population databases (no rsID available, gnomAD 0.02%). This variant has been observed in individual(s) with cartilage-hair hypoplasia (CHH) (PMID: 15780958, 16838329). In at least one individual the data is consistent with being in trans (on the opposite chromosome) from a pathogenic variant. This variant is also known as -4_-23dup, -5_-24dup, and -6_-25dup. ClinVar contains an entry for this variant (Variation ID: 550387). Algorithms developed to predict the effect of variants on protein structure and function are not available or were not evaluated for this variant. Experimental studies have shown that this variant affects RMRP function (PMID: 16254002). For these reasons, this variant has been classified as Pathogenic. -

Metaphyseal chondrodysplasia, McKusick type;C1834821:Metaphyseal dysplasia without hypotrichosis;C4551965:Anauxetic dysplasia 1 Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

Fulgent Genetics, Fulgent Genetics

May 05, 2022

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1554651411; hg19: chr9-35658017;