rs1554657940
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate
The NM_000127.3(EXT1):c.1633-34_1670delTCCCTCCCCACTGCCTACTTCTACTTCCTCCCAGGTTATGAGCAGCCGTTTTCTGCCCTACGACAACATCAT(p.Val545fs) variant causes a frameshift, splice acceptor, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. V545V) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_000127.3 frameshift, splice_acceptor, splice_region, intron
Scores
Clinical Significance
Conservation
Publications
- exostoses, multiple, type 1Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P, ClinGen
- chondrosarcomaInheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
- hereditary multiple osteochondromasInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000127.3. You can select a different transcript below to see updated ACMG assignments.
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| EXT1 | TSL:1 MANE Select | c.1633-34_1670delTCCCTCCCCACTGCCTACTTCTACTTCCTCCCAGGTTATGAGCAGCCGTTTTCTGCCCTACGACAACATCAT | p.Val545fs | frameshift splice_acceptor splice_region intron | Exon 8 of 11 | ENSP00000367446.3 | Q16394 | ||
| EXT1 | TSL:5 | n.*524-34_*561delTCCCTCCCCACTGCCTACTTCTACTTCCTCCCAGGTTATGAGCAGCCGTTTTCTGCCCTACGACAACATCAT | splice_region non_coding_transcript_exon | Exon 7 of 10 | ENSP00000407299.1 | F8WF54 | |||
| EXT1 | TSL:5 | n.*524-34_*561delTCCCTCCCCACTGCCTACTTCTACTTCCTCCCAGGTTATGAGCAGCCGTTTTCTGCCCTACGACAACATCAT | splice_acceptor splice_region 3_prime_UTR intron | Exon 7 of 10 | ENSP00000407299.1 | F8WF54 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at