rs1554657940

Variant names:

• chr8-117812923-GATGATGTTGTCGTAGGGCAGAAAACGGCTGCTCATAACCTGGGAGGAAGTAGAAGTAGGCAGTGGGGAGGGA-G
• rs1554657940
• NM_000127.3:c.1633-34_1670delTCCCTCCCCACTGCCTACTTCTACTTCCTCCCAGGTTATGAGCAGCCGTTTTCTGCCCTACGACAACATCAT

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_000127.3(EXT1):​c.1633-34_1670delTCCCTCCCCACTGCCTACTTCTACTTCCTCCCAGGTTATGAGCAGCCGTTTTCTGCCCTACGACAACATCAT​(p.Val545fs) variant causes a frameshift, splice acceptor, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. V545V) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: EXT1 NM_000127.3 frameshift, splice_acceptor, splice_region, intron
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 9.04
• Publications: 0 publications found

Genes affected

EXT1 (HGNC:3512): (exostosin glycosyltransferase 1) This gene encodes an endoplasmic reticulum-resident type II transmembrane glycosyltransferase involved in the chain elongation step of heparan sulfate biosynthesis. Mutations in this gene cause the type I form of multiple exostoses. [provided by RefSeq, Jul 2008]

EXT1 Gene-Disease associations (from GenCC):

• exostoses, multiple, type 1

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P, ClinGen
• chondrosarcoma

  Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
• hereditary multiple osteochondromas

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 8-117812923-GATGATGTTGTCGTAGGGCAGAAAACGGCTGCTCATAACCTGGGAGGAAGTAGAAGTAGGCAGTGGGGAGGGA-G is Pathogenic according to our data. Variant chr8-117812923-GATGATGTTGTCGTAGGGCAGAAAACGGCTGCTCATAACCTGGGAGGAAGTAGAAGTAGGCAGTGGGGAGGGA-G is described in ClinVar as Pathogenic. ClinVar VariationId is 456063.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000127.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	EXT1	NM_000127.3	MANE Select	c.1633-34_1670delTCCCTCCCCACTGCCTACTTCTACTTCCTCCCAGGTTATGAGCAGCCGTTTTCTGCCCTACGACAACATCAT	p.Val545fs	frameshift splice_acceptor splice_region intron	Exon 8 of 11	NP_000118.2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	EXT1	ENST00000378204.7	TSL:1 MANE Select	c.1633-34_1670delTCCCTCCCCACTGCCTACTTCTACTTCCTCCCAGGTTATGAGCAGCCGTTTTCTGCCCTACGACAACATCAT	p.Val545fs	frameshift splice_acceptor splice_region intron	Exon 8 of 11	ENSP00000367446.3	Q16394
	EXT1	ENST00000437196.1	TSL:5	n.*524-34_*561delTCCCTCCCCACTGCCTACTTCTACTTCCTCCCAGGTTATGAGCAGCCGTTTTCTGCCCTACGACAACATCAT		splice_region non_coding_transcript_exon	Exon 7 of 10	ENSP00000407299.1	F8WF54
	EXT1	ENST00000437196.1	TSL:5	n.*524-34_*561delTCCCTCCCCACTGCCTACTTCTACTTCCTCCCAGGTTATGAGCAGCCGTTTTCTGCCCTACGACAACATCAT		splice_acceptor splice_region 3_prime_UTR intron	Exon 7 of 10	ENSP00000407299.1	F8WF54

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
1	-	-	Multiple congenital exostosis (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.0
Mutation Taster		=4/196	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1554657940; hg19: chr8-118825162;