rs1554657940

Variant names:

• chr8-117812923-GATGATGTTGTCGTAGGGCAGAAAACGGCTGCTCATAACCTGGGAGGAAGTAGAAGTAGGCAGTGGGGAGGGA-G
• rs1554657940
• NM_000127.3:c.1633-34_1670delTCCCTCCCCACTGCCTACTTCTACTTCCTCCCAGGTTATGAGCAGCCGTTTTCTGCCCTACGACAACATCAT

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1 PM2 PP5_Moderate

The NM_000127.3(EXT1):​c.1633-34_1670delTCCCTCCCCACTGCCTACTTCTACTTCCTCCCAGGTTATGAGCAGCCGTTTTCTGCCCTACGACAACATCAT​(p.Val545fs) variant causes a frameshift, splice acceptor, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: EXT1 NM_000127.3 frameshift, splice_acceptor, splice_region, intron
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 9.04

Genes affected

EXT1 (HGNC:3512): (exostosin glycosyltransferase 1) This gene encodes an endoplasmic reticulum-resident type II transmembrane glycosyltransferase involved in the chain elongation step of heparan sulfate biosynthesis. Mutations in this gene cause the type I form of multiple exostoses. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 8-117812923-GATGATGTTGTCGTAGGGCAGAAAACGGCTGCTCATAACCTGGGAGGAAGTAGAAGTAGGCAGTGGGGAGGGA-G is Pathogenic according to our data. Variant chr8-117812923-GATGATGTTGTCGTAGGGCAGAAAACGGCTGCTCATAACCTGGGAGGAAGTAGAAGTAGGCAGTGGGGAGGGA-G is described in ClinVar as [Pathogenic]. Clinvar id is 456063.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
EXT1	NM_000127.3	c.1633-34_1670delTCCCTCCCCACTGCCTACTTCTACTTCCTCCCAGGTTATGAGCAGCCGTTTTCTGCCCTACGACAACATCAT	p.Val545fs	frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant	Exon 8 of 11	ENST00000378204.7	NP_000118.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
EXT1	ENST00000378204.7	c.1633-34_1670delTCCCTCCCCACTGCCTACTTCTACTTCCTCCCAGGTTATGAGCAGCCGTTTTCTGCCCTACGACAACATCAT	p.Val545fs	frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant	Exon 8 of 11	1	NM_000127.3	ENSP00000367446.3
EXT1	ENST00000437196.1	n.*524-34_*561delTCCCTCCCCACTGCCTACTTCTACTTCCTCCCAGGTTATGAGCAGCCGTTTTCTGCCCTACGACAACATCAT		splice_region_variant, non_coding_transcript_exon_variant	Exon 7 of 10	5		ENSP00000407299.1
EXT1	ENST00000437196.1	n.*524-34_*561delTCCCTCCCCACTGCCTACTTCTACTTCCTCCCAGGTTATGAGCAGCCGTTTTCTGCCCTACGACAACATCAT		splice_acceptor_variant, splice_region_variant, 3_prime_UTR_variant, intron_variant	Exon 7 of 10	5		ENSP00000407299.1
EXT1	ENST00000684189.1	n.1100-34_1137delTCCCTCCCCACTGCCTACTTCTACTTCCTCCCAGGTTATGAGCAGCCGTTTTCTGCCCTACGACAACATCAT		splice_acceptor_variant, splice_region_variant, intron_variant, non_coding_transcript_exon_variant	Exon 8 of 11

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Multiple congenital exostosis Pathogenic:1

Aug 10, 2017

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant is a gross deletion of the genomic region encompassing part of exon 8 of the EXT1 gene, including the intron 7-exon 8 boundary (c.1633-34_1670del). This likely creates a premature translational stop signal and is expected to result in an absent or disrupted protein product. This variant is not present in population databases (ExAC no frequency). Loss-of-function variants in EXT1 are known to be pathogenic (PMID: 10679937, 11391482, 19810120). For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1554657940; hg19: chr8-118825162;