rs1554707622
- chr9-34635591-CGCTCCTGTCTATCCGCAGGTCTTCCTTCAGGCCTGGCTGGTCAAGGGTCCTGGCCAAAGAGGTAGGTGGTGAGCTCAAGCCGGAGGCCCCGAGCATAGGAGCGAAGAGTATAGAAGAGGGTGAGGAAGTCCTGGGTGCTGAAGACAGTGTCGGCCAGCGCGAAGGCCAGGGTGGATGGGATGACGCCCCGGCCGTACTCCACCATCCATGTGTTTGGCCCCCACTCCACAGCTGTTGCCTCACCAGGCCCGTGTACTACCGTCTCCCCTGGGGGACAGGGAGCACCCAAGTG-C
- rs1554707622
- NM_005866.4:c.446-25_*40del
Variant summary
Our verdict is Likely pathogenic. The variant received 6 ACMG points: 6P and 0B. PM1PM4PP5_Moderate
The NM_005866.4(SIGMAR1):c.446-25_*40del(p.Gly149_Ter224delins???) variant causes a stop lost, conservative inframe deletion, splice region change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★).
Frequency
Consequence
NM_005866.4 stop_lost, conservative_inframe_deletion, splice_region
Scores
Clinical Significance
Conservation
Publications
- amyotrophic lateral sclerosis type 16Inheritance: AR Classification: STRONG, MODERATE Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp
- autosomal recessive distal spinal muscular atrophy 2Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae)
- juvenile amyotrophic lateral sclerosisInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 6 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_005866.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| SIGMAR1 | NM_005866.4 | MANE Select | c.446-25_*40del | p.Gly149_Ter224delins??? | stop_lost conservative_inframe_deletion splice_region | Exon 4 of 4 | NP_005857.1 | Q99720-1 | |
| SIGMAR1 | NM_005866.4 | MANE Select | c.446-25_*40del | splice_acceptor splice_region 3_prime_UTR intron | Exon 4 of 4 | NP_005857.1 | Q99720-1 | ||
| SIGMAR1 | NM_001282207.2 | c.386-25_*40del | p.Gly129_Ter204delins??? | stop_lost conservative_inframe_deletion splice_region | Exon 4 of 4 | NP_001269136.1 | Q99720-2 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| SIGMAR1 | ENST00000277010.9 | TSL:1 MANE Select | c.446-25_*40del | p.Gly149_Ter224delins??? | stop_lost conservative_inframe_deletion splice_region | Exon 4 of 4 | ENSP00000277010.4 | Q99720-1 | |
| SIGMAR1 | ENST00000477726.1 | TSL:1 | c.353-25_*40del | p.Gly118_Ter193delins??? | stop_lost conservative_inframe_deletion splice_region | Exon 3 of 3 | ENSP00000420022.1 | Q99720-3 | |
| SIGMAR1 | ENST00000277010.9 | TSL:1 MANE Select | c.446-25_*40del | splice_acceptor splice_region 3_prime_UTR intron | Exon 4 of 4 | ENSP00000277010.4 | Q99720-1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at