rs1554725677

Positions:

• chr9-130499495-C-CTCCTTGCAGCATGAACGTGCAGGGTGATTATGAGCCAACTGATGCCACCGGGTTCATCAACATCAAT

Variant summary

Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1 PM2 PP5_Very_Strong

The NM_054012.4(ASS1):​c.1128-6_1188dupTTGCAGCATGAACGTGCAGGGTGATTATGAGCCAACTGATGCCACCGGGTTCATCAACATCAATTCC​(p.Arg398fs) variant causes a frameshift, stop gained change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★★). Variant results in nonsense mediated mRNA decay.

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0000027 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: ASS1 NM_054012.4 frameshift, stop_gained
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:4
• Conservation: PhyloP100: 0.338

Genes affected

ASS1 (HGNC:758): (argininosuccinate synthase 1) The protein encoded by this gene catalyzes the penultimate step of the arginine biosynthetic pathway. There are approximately 10 to 14 copies of this gene including the pseudogenes scattered across the human genome, among which the one located on chromosome 9 appears to be the only functional gene for argininosuccinate synthetase. Mutations in the chromosome 9 copy of this gene cause citrullinemia. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Aug 2012]

ASS1 (HGNC:):

ACMG classification

Verdict is Pathogenic. Variant got 18 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 9-130499495-C-CTCCTTGCAGCATGAACGTGCAGGGTGATTATGAGCCAACTGATGCCACCGGGTTCATCAACATCAAT is Pathogenic according to our data. Variant chr9-130499495-C-CTCCTTGCAGCATGAACGTGCAGGGTGATTATGAGCCAACTGATGCCACCGGGTTCATCAACATCAAT is described in ClinVar as [Pathogenic]. Clinvar id is 495381.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
ASS1	NM_054012.4	c.1128-6_1188dupTTGCAGCATGAACGTGCAGGGTGATTATGAGCCAACTGATGCCACCGGGTTCATCAACATCAATTCC	p.Arg398fs	frameshift_variant, stop_gained	14/15	ENST00000352480.10	NP_446464.1
ASS1	NM_000050.4	c.1128-6_1188dupTTGCAGCATGAACGTGCAGGGTGATTATGAGCCAACTGATGCCACCGGGTTCATCAACATCAATTCC	p.Arg398fs	frameshift_variant, stop_gained	15/16		NP_000041.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
ASS1	ENST00000352480.10	c.1128-6_1188dupTTGCAGCATGAACGTGCAGGGTGATTATGAGCCAACTGATGCCACCGGGTTCATCAACATCAATTCC	p.Arg398fs	frameshift_variant, stop_gained	14/15	1	NM_054012.4	ENSP00000253004.6
ASS1	ENST00000372393.7	c.1128-6_1188dupTTGCAGCATGAACGTGCAGGGTGATTATGAGCCAACTGATGCCACCGGGTTCATCAACATCAATTCC	p.Arg398fs	frameshift_variant, stop_gained	15/16	5		ENSP00000361469.2
ASS1	ENST00000372394.5	c.1128-6_1188dupTTGCAGCATGAACGTGCAGGGTGATTATGAGCCAACTGATGCCACCGGGTTCATCAACATCAATTCC	p.Arg398fs	frameshift_variant, stop_gained	15/16	2		ENSP00000361471.1
ASS1	ENST00000372386.6	n.399-6_459dupTTGCAGCATGAACGTGCAGGGTGATTATGAGCCAACTGATGCCACCGGGTTCATCAACATCAATTCC		non_coding_transcript_exon_variant	5/6	3

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000274 AC: 4 AN: 1460838 Hom.: 0 Cov.: 31 AF XY: 0.00000275 AC XY: 2 AN XY: 726568

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.000101

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:4

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Citrullinemia Pathogenic:2

Pathogenic, criteria provided, single submitter	clinical testing	Women's Health and Genetics/Laboratory Corporation of America, LabCorp	Apr 25, 2023	Variant summary: ASS1 c.1128-6_1188dup67 (p.Arg398Glnfs*7) is expected to create a premature stop codon resulting in a truncated or absent protein. The variant was absent in 249548 control chromosomes. c.1128-6_1188dup67 has been reported in the literature in multiple individuals affected with Citrullinemia Type I (Lee_2013, Woo_2013). These data indicate that the variant is very likely to be associated with disease. To our knowledge, no experimental evidence demonstrating an impact on protein function has been reported. The following publications have been ascertained in the context of this evaluation (PMID: 23246278, 23099195). Two clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar after 2014 without evidence for independent evaluation. All laboratories classified the variant as pathogenic. Based on the evidence outlined above, the variant was classified as pathogenic. -
Pathogenic, criteria provided, single submitter	clinical testing	Labcorp Genetics (formerly Invitae), Labcorp	Aug 07, 2021	This sequence change creates a premature translational stop signal (p.Arg398Glnfs*7) in the ASS1 gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 15 amino acid(s) of the ASS1 protein. This variant is not present in population databases (ExAC no frequency). This premature translational stop signal has been observed in individuals with citrullinemia type I (PMID: 12815590, 23099195, 23246278). This variant is also known as 1127_1128ins67. ClinVar contains an entry for this variant (Variation ID: 495381). Variants that disrupt the consensus splice site are a relatively common cause of aberrant splicing (PMID: 17576681, 9536098). Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may create or strengthen a splice site. For these reasons, this variant has been classified as Pathogenic. -

Citrullinemia type I Pathogenic:2

Pathogenic, criteria provided, single submitter	clinical testing	Women's Health and Genetics/Laboratory Corporation of America, LabCorp	Feb 02, 2016	- -
Pathogenic, criteria provided, single submitter	clinical testing	3billion	Oct 02, 2021	Frameshift: predicted to result in a loss or disruption of normal protein function through nonsense-mediated decay (NMD) or protein truncation. Multiple pathogenic variants are reported downstream of the variant. It is not observed in the gnomAD v2.1.1 dataset (PM2). The variant has been reported at least twice as pathogenic/likely pathogenic with clinical assertions and evidence for the classification (ClinVar ID: VCV000495381.3). Therefore, this variant is classified as pathogenic according to the recommendation of ACMG/AMP guideline. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1554725677; hg19: chr9-133374882;