rs1554725677

Variant names:

• chr9-130499495-C-CTCCTTGCAGCATGAACGTGCAGGGTGATTATGAGCCAACTGATGCCACCGGGTTCATCAACATCAAT
• rs1554725677
• NM_054012.4:c.1128-6_1188dupTTGCAGCATGAACGTGCAGGGTGATTATGAGCCAACTGATGCCACCGGGTTCATCAACATCAATTCC

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_054012.4(ASS1):​c.1128-6_1188dupTTGCAGCATGAACGTGCAGGGTGATTATGAGCCAACTGATGCCACCGGGTTCATCAACATCAATTCC​(p.Arg398fs) variant causes a frameshift, stop gained change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. L397L) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0000027 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: ASS1 NM_054012.4 frameshift, stop_gained
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:5
• Conservation: PhyloP100: 0.338
• Publications: 0 publications found

Genes affected

ASS1 (HGNC:758): (argininosuccinate synthase 1) The protein encoded by this gene catalyzes the penultimate step of the arginine biosynthetic pathway. There are approximately 10 to 14 copies of this gene including the pseudogenes scattered across the human genome, among which the one located on chromosome 9 appears to be the only functional gene for argininosuccinate synthetase. Mutations in the chromosome 9 copy of this gene cause citrullinemia. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Aug 2012]

ASS1 Gene-Disease associations (from GenCC):

• citrullinemia type I

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), ClinGen, G2P, Myriad Women’s Health
• acute neonatal citrullinemia type I

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• adult-onset citrullinemia type I

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 9-130499495-C-CTCCTTGCAGCATGAACGTGCAGGGTGATTATGAGCCAACTGATGCCACCGGGTTCATCAACATCAAT is Pathogenic according to our data. Variant chr9-130499495-C-CTCCTTGCAGCATGAACGTGCAGGGTGATTATGAGCCAACTGATGCCACCGGGTTCATCAACATCAAT is described in ClinVar as Pathogenic. ClinVar VariationId is 495381.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_054012.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ASS1	NM_054012.4	MANE Select	c.1128-6_1188dupTTGCAGCATGAACGTGCAGGGTGATTATGAGCCAACTGATGCCACCGGGTTCATCAACATCAATTCC	p.Arg398fs	frameshift stop_gained	Exon 14 of 15	NP_446464.1	Q5T6L4
	ASS1	NM_000050.4		c.1128-6_1188dupTTGCAGCATGAACGTGCAGGGTGATTATGAGCCAACTGATGCCACCGGGTTCATCAACATCAATTCC	p.Arg398fs	frameshift stop_gained	Exon 15 of 16	NP_000041.2	P00966

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ASS1	ENST00000352480.10	TSL:1 MANE Select	c.1128-10_1128-9insTCCTTGCAGCATGAACGTGCAGGGTGATTATGAGCCAACTGATGCCACCGGGTTCATCAACATCAAT		intron	N/A	ENSP00000253004.6	P00966
	ASS1	ENST00000852201.1		c.1323-10_1323-9insTCCTTGCAGCATGAACGTGCAGGGTGATTATGAGCCAACTGATGCCACCGGGTTCATCAACATCAAT		intron	N/A	ENSP00000522260.1
	ASS1	ENST00000852207.1		c.1251-10_1251-9insTCCTTGCAGCATGAACGTGCAGGGTGATTATGAGCCAACTGATGCCACCGGGTTCATCAACATCAAT		intron	N/A	ENSP00000522266.1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000274 AC: 4 AN: 1460838 Hom.: 0 Cov.: 31 AF XY: 0.00000275 AC XY: 2 AN XY: 726568

African (AFR) AF: 0.00 AC: 0 AN: 33458

American (AMR) AF: 0.00 AC: 0 AN: 44622

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26074

East Asian (EAS) AF: 0.000101 AC: 4 AN: 39688

South Asian (SAS) AF: 0.00 AC: 0 AN: 85846

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53368

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5754

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 1111656

Other (OTH) AF: 0.00 AC: 0 AN: 60372

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
3	-	-	Citrullinemia type I (3)
2	-	-	Citrullinemia (2)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.34
Mutation Taster		=6/94	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1554725677; hg19: chr9-133374882;