Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate
The NM_000368.5(TSC1):c.2341_2360dupCAGCTGCAGCATGACCGAGA(p.Glu787AspfsTer27) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.
TSC1 (HGNC:12362): (TSC complex subunit 1) This gene is a tumor suppressor gene that encodes the growth inhibitory protein hamartin. The encoded protein interacts with and stabilizes the GTPase activating protein tuberin. This hamartin-tuberin complex negatively regulates mammalian target of rapamycin complex 1 (mTORC1) signaling which is a major regulator of anabolic cell growth. This protein also functions as a co-chaperone for Hsp90 that inhibits its ATPase activity. This protein functions as a facilitator of Hsp90-mediated folding of kinase and non-kinase clients, including TSC2 and thereby preventing their ubiquitination and proteasomal degradation. Mutations in this gene have been associated with tuberous sclerosis and lymphangioleiomyomatosis. [provided by RefSeq, May 2022]
Verdict is Pathogenic. Variant got 12 ACMG points.
PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 9-132902635-C-CTCTCGGTCATGCTGCAGCTG is Pathogenic according to our data. Variant chr9-132902635-C-CTCTCGGTCATGCTGCAGCTG is described in ClinVar as [Pathogenic]. Clinvar id is 411223.Status of the report is criteria_provided_single_submitter, 1 stars.
Review Status: criteria provided, single submitter
Collection Method: clinical testing
This sequence change inserts 20 nucleotides in exon 18 of the TSC1 mRNA (c.2341_2360dup20), causing a frameshift at codon 787. This creates a premature translational stop signal (p.Glu787Aspfs*27) and is expected to result in an absent or disrupted protein product. While this particular variant has not been reported in the literature, loss-of-function variants in TSC1 are known to be pathogenic (PMID: 10227394, 17304050). For these reasons, this variant has been classified as Pathogenic. -