rs1555120937

Variant summary

Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1PM2PP5_Very_Strong

The NM_000256.3(MYBPC3):​c.2648_2673dupACACCACGGTCTCCCTCAAGTGGCGG​(p.Pro892ThrfsTer41) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★★). Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 30)

Consequence

MYBPC3
NM_000256.3 frameshift

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, multiple submitters, no conflicts P:2

Conservation

PhyloP100: 0.0100
Variant links:
Genes affected
MYBPC3 (HGNC:7551): (myosin binding protein C3) MYBPC3 encodes the cardiac isoform of myosin-binding protein C. Myosin-binding protein C is a myosin-associated protein found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. MYBPC3 is expressed exclusively in heart muscle and is a key regulator of cardiac contraction. Mutations in this gene are a frequent cause of familial hypertrophic cardiomyopathy. [provided by RefSeq, May 2022]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 18 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 11-47335940-G-GCCGCCACTTGAGGGAGACCGTGGTGT is Pathogenic according to our data. Variant chr11-47335940-G-GCCGCCACTTGAGGGAGACCGTGGTGT is described in ClinVar as [Pathogenic]. Clinvar id is 454318.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
MYBPC3NM_000256.3 linkc.2648_2673dupACACCACGGTCTCCCTCAAGTGGCGG p.Pro892ThrfsTer41 frameshift_variant Exon 26 of 35 ENST00000545968.6 NP_000247.2 Q14896-1A5YM48

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
MYBPC3ENST00000545968.6 linkc.2648_2673dupACACCACGGTCTCCCTCAAGTGGCGG p.Pro892ThrfsTer41 frameshift_variant Exon 26 of 35 5 NM_000256.3 ENSP00000442795.1 Q14896-1
MYBPC3ENST00000399249.6 linkc.2648_2673dupACACCACGGTCTCCCTCAAGTGGCGG p.Pro892ThrfsTer41 frameshift_variant Exon 25 of 34 5 ENSP00000382193.2 A8MXZ9
MYBPC3ENST00000544791.1 linkn.*153_*178dupACACCACGGTCTCCCTCAAGTGGCGG non_coding_transcript_exon_variant Exon 26 of 27 5 ENSP00000444259.1 F5GZR4
MYBPC3ENST00000544791.1 linkn.*153_*178dupACACCACGGTCTCCCTCAAGTGGCGG 3_prime_UTR_variant Exon 26 of 27 5 ENSP00000444259.1 F5GZR4

Frequencies

GnomAD3 genomes
Cov.:
30
GnomAD4 exome
Cov.:
33
GnomAD4 genome
Cov.:
30

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:2
Revision: criteria provided, multiple submitters, no conflicts
LINK: link

Submissions by phenotype

not provided Pathogenic:1
Nov 01, 2023
GeneDx
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

Has not been previously published as pathogenic or benign to our knowledge; Not observed at significant frequency in large population cohorts (gnomAD); Frameshift variant predicted to result in protein truncation or nonsense mediated decay in a gene for which loss of function is a known mechanism of disease -

Hypertrophic cardiomyopathy Pathogenic:1
Jul 13, 2021
Labcorp Genetics (formerly Invitae), Labcorp
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may create or strengthen a splice site. For these reasons, this variant has been classified as Pathogenic. ClinVar contains an entry for this variant (Variation ID: 454318). This variant has not been reported in the literature in individuals affected with MYBPC3-related conditions. This variant is not present in population databases (ExAC no frequency). This sequence change creates a premature translational stop signal (p.Pro892Thrfs*41) in the MYBPC3 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in MYBPC3 are known to be pathogenic (PMID: 19574547). -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1555120937; hg19: chr11-47357491; API