rs1555120937

Variant names:

• chr11-47335940-G-GCCGCCACTTGAGGGAGACCGTGGTGT
• rs1555120937
• NM_000256.3:c.2648_2673dupACACCACGGTCTCCCTCAAGTGGCGG

Variant summary

Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1 PM2 PP5_Very_Strong

The NM_000256.3(MYBPC3):​c.2648_2673dupACACCACGGTCTCCCTCAAGTGGCGG​(p.Pro892ThrfsTer41) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 30)
• Consequence: MYBPC3 NM_000256.3 frameshift
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:2
• Conservation: PhyloP100: 0.0100

Genes affected

MYBPC3 (HGNC:7551): (myosin binding protein C3) MYBPC3 encodes the cardiac isoform of myosin-binding protein C. Myosin-binding protein C is a myosin-associated protein found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. MYBPC3 is expressed exclusively in heart muscle and is a key regulator of cardiac contraction. Mutations in this gene are a frequent cause of familial hypertrophic cardiomyopathy. [provided by RefSeq, May 2022]

ACMG classification

Verdict is Pathogenic. Variant got 18 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 11-47335940-G-GCCGCCACTTGAGGGAGACCGTGGTGT is Pathogenic according to our data. Variant chr11-47335940-G-GCCGCCACTTGAGGGAGACCGTGGTGT is described in ClinVar as [Pathogenic]. Clinvar id is 454318.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MYBPC3	NM_000256.3	c.2648_2673dupACACCACGGTCTCCCTCAAGTGGCGG	p.Pro892ThrfsTer41	frameshift_variant	Exon 26 of 35	ENST00000545968.6	NP_000247.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MYBPC3	ENST00000545968.6	c.2648_2673dupACACCACGGTCTCCCTCAAGTGGCGG	p.Pro892ThrfsTer41	frameshift_variant	Exon 26 of 35	5	NM_000256.3	ENSP00000442795.1
MYBPC3	ENST00000399249.6	c.2648_2673dupACACCACGGTCTCCCTCAAGTGGCGG	p.Pro892ThrfsTer41	frameshift_variant	Exon 25 of 34	5		ENSP00000382193.2
MYBPC3	ENST00000544791.1	n.*153_*178dupACACCACGGTCTCCCTCAAGTGGCGG		non_coding_transcript_exon_variant	Exon 26 of 27	5		ENSP00000444259.1
MYBPC3	ENST00000544791.1	n.*153_*178dupACACCACGGTCTCCCTCAAGTGGCGG		3_prime_UTR_variant	Exon 26 of 27	5		ENSP00000444259.1

Frequencies

GnomAD3 genomes Cov.: 30

GnomAD4 exome Cov.: 33

GnomAD4 genome Cov.: 30

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not provided Pathogenic:1

Nov 01, 2023

GeneDx

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Has not been previously published as pathogenic or benign to our knowledge; Not observed at significant frequency in large population cohorts (gnomAD); Frameshift variant predicted to result in protein truncation or nonsense mediated decay in a gene for which loss of function is a known mechanism of disease -

Hypertrophic cardiomyopathy Pathogenic:1

Jul 13, 2021

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may create or strengthen a splice site. For these reasons, this variant has been classified as Pathogenic. ClinVar contains an entry for this variant (Variation ID: 454318). This variant has not been reported in the literature in individuals affected with MYBPC3-related conditions. This variant is not present in population databases (ExAC no frequency). This sequence change creates a premature translational stop signal (p.Pro892Thrfs*41) in the MYBPC3 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in MYBPC3 are known to be pathogenic (PMID: 19574547). -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555120937; hg19: chr11-47357491;