rs1555225627

Variant names:

• chr12-132659279-T-TGGGGGGAGCCCTCACCTCTCCGTGAC
• rs1555225627
• NM_006231.4:c.3265_3275+15dupGTCACGGAGAGGTGAGGGCTCCCCCC

Variant summary

Our verdict is Benign. The variant received -16 ACMG points: 0P and 16B. BP6_Very_Strong BS1 BS2

The NM_006231.4(POLE):​c.3265_3275+15dupGTCACGGAGAGGTGAGGGCTCCCCCC variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0086 in 150,724 control chromosomes in the GnomAD database, including 12 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★★).

• Frequency:
  • Genomes: 𝑓 0.0086 (12 hom., cov: 33)
  • Exomes 𝑓: 0.00082 (14 hom.)
  • Failed GnomAD Quality Control
• Consequence: POLE NM_006231.4 intron
• Clinical Significance: Benign/Likely benign criteria provided, multiple submitters, no conflicts B:6
• Conservation: PhyloP100: -1.71
• Publications: 0 publications found

Genes affected

POLE (HGNC:9177): (DNA polymerase epsilon, catalytic subunit) This gene encodes the catalytic subunit of DNA polymerase epsilon. The enzyme is involved in DNA repair and chromosomal DNA replication. Mutations in this gene have been associated with colorectal cancer 12 and facial dysmorphism, immunodeficiency, livedo, and short stature. [provided by RefSeq, Sep 2013]

POLE Gene-Disease associations (from GenCC):

• POLE-related polyposis and colorectal cancer syndrome

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• colorectal cancer, susceptibility to, 12

  Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp, Ambry Genetics
• facial dysmorphism-immunodeficiency-livedo-short stature syndrome

  Inheritance: AR Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Ambry Genetics
• intrauterine growth retardation, metaphyseal dysplasia, adrenal hypoplasia congenita, genital anomalies, and immunodeficiency

  Inheritance: AR Classification: STRONG Submitted by: G2P
• IMAGe syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Polymerase proofreading-related adenomatous polyposis

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Benign. The variant received -16 ACMG points.

• BP6: Variant 12-132659279-T-TGGGGGGAGCCCTCACCTCTCCGTGAC is Benign according to our data. Variant chr12-132659279-T-TGGGGGGAGCCCTCACCTCTCCGTGAC is described in ClinVar as Benign/Likely_benign. ClinVar VariationId is 240462.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BS1: Variant frequency is greater than expected in population afr. GnomAd4 allele frequency = 0.0086 (1296/150724) while in subpopulation AFR AF = 0.0302 (1239/41010). AF 95% confidence interval is 0.0288. There are 12 homozygotes in GnomAd4. There are 614 alleles in the male GnomAd4 subpopulation. Median coverage is 33. This position passed quality control check.
• BS2: High Homozygotes in GnomAd4 at 12 AD,AR gene

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_006231.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	POLE	NM_006231.4	MANE Select	c.3265_3275+15dupGTCACGGAGAGGTGAGGGCTCCCCCC		intron	N/A	NP_006222.2	Q07864

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	POLE	ENST00000320574.10	TSL:1 MANE Select	c.3275+15_3275+16insGTCACGGAGAGGTGAGGGCTCCCCCC		intron	N/A	ENSP00000322570.5	Q07864
	POLE	ENST00000535270.5	TSL:1	c.3194+15_3194+16insGTCACGGAGAGGTGAGGGCTCCCCCC		intron	N/A	ENSP00000445753.1	F5H1D6
	POLE	ENST00000537064.5	TSL:1	n.*2322+15_*2322+16insGTCACGGAGAGGTGAGGGCTCCCCCC		intron	N/A	ENSP00000442578.1	F5H7E4

Frequencies

GnomAD3 genomes AF: 0.00861 AC: 1296 AN: 150602 Hom.: 12 Cov.: 33

Gnomad AFR AF: 0.0303

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00264

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000888

Gnomad OTH AF: 0.00530

GnomAD2 exomes AF: 0.00190 AC: 468 AN: 246754 AF XY: 0.00147

Gnomad AFR exome AF: 0.0250

Gnomad AMR exome AF: 0.00189

Gnomad ASJ exome AF: 0.000100

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000362

Gnomad OTH exome AF: 0.000495

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000821 AC: 1196 AN: 1456310 Hom.: 14 Cov.: 32 AF XY: 0.000709 AC XY: 514 AN XY: 724712

African (AFR) AF: 0.0298 AC: 993 AN: 33332

American (AMR) AF: 0.00179 AC: 80 AN: 44632

Ashkenazi Jewish (ASJ) AF: 0.0000384 AC: 1 AN: 26068

East Asian (EAS) AF: 0.00 AC: 0 AN: 39628

South Asian (SAS) AF: 0.0000349 AC: 3 AN: 86032

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 52758

Middle Eastern (MID) AF: 0.000874 AC: 5 AN: 5718

European-Non Finnish (NFE) AF: 0.0000135 AC: 15 AN: 1107986

Other (OTH) AF: 0.00165 AC: 99 AN: 60156

GnomAD4 genome AF: 0.00860 AC: 1296 AN: 150724 Hom.: 12 Cov.: 33 AF XY: 0.00834 AC XY: 614 AN XY: 73662

African (AFR) AF: 0.0302 AC: 1239 AN: 41010

American (AMR) AF: 0.00263 AC: 40 AN: 15182

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3450

East Asian (EAS) AF: 0.00 AC: 0 AN: 5130

South Asian (SAS) AF: 0.00 AC: 0 AN: 4728

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10390

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 292

European-Non Finnish (NFE) AF: 0.0000888 AC: 6 AN: 67544

Other (OTH) AF: 0.00524 AC: 11 AN: 2098

Alfa AF: 0.000305 Hom.: 0

ClinVar

ClinVar submissions

Significance: Benign/Likely benign

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	-	2	not specified (2)
-	-	1	Colorectal cancer, susceptibility to, 12 (1)
-	-	1	Familial colorectal cancer type X;C5202613:Polymerase proofreading-related adenomatous polyposis (1)
-	-	1	Hereditary cancer-predisposing syndrome (1)
-	-	1	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		-1.7
Mutation Taster		=100/0	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555225627; hg19: chr12-133235865;