rs1555225627
Variant summary
Our verdict is Benign. The variant received -16 ACMG points: 0P and 16B. BP6_Very_StrongBS1BS2
The NM_006231.4(POLE):c.3265_3275+15dupGTCACGGAGAGGTGAGGGCTCCCCCC variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0086 in 150,724 control chromosomes in the GnomAD database, including 12 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★★).
Frequency
Consequence
NM_006231.4 intron
Scores
Clinical Significance
Conservation
Publications
- POLE-related polyposis and colorectal cancer syndromeInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- colorectal cancer, susceptibility to, 12Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Ambry Genetics
- facial dysmorphism-immunodeficiency-livedo-short stature syndromeInheritance: AR Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Ambry Genetics
- intrauterine growth retardation, metaphyseal dysplasia, adrenal hypoplasia congenita, genital anomalies, and immunodeficiencyInheritance: AR Classification: STRONG Submitted by: G2P
- IMAGe syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Polymerase proofreading-related adenomatous polyposisInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Benign. The variant received -16 ACMG points.
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes AF: 0.00861 AC: 1296AN: 150602Hom.: 12 Cov.: 33 show subpopulations
GnomAD2 exomes AF: 0.00190 AC: 468AN: 246754 AF XY: 0.00147 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000821 AC: 1196AN: 1456310Hom.: 14 Cov.: 32 AF XY: 0.000709 AC XY: 514AN XY: 724712 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.00860 AC: 1296AN: 150724Hom.: 12 Cov.: 33 AF XY: 0.00834 AC XY: 614AN XY: 73662 show subpopulations
Age Distribution
ClinVar
Submissions by phenotype
not specified Benign:2
This variant is considered likely benign or benign based on one or more of the following criteria: it is a conservative change, it occurs at a poorly conserved position in the protein, it is predicted to be benign by multiple in silico algorithms, and/or has population frequency not consistent with disease. -
- -
Polymerase proofreading-related adenomatous polyposis;C3896578:Familial colorectal cancer type X Benign:1
- -
Colorectal cancer, susceptibility to, 12 Benign:1
This submission and the accompanying classification are no longer maintained by the submitter. For more information on current observations and classification, please contact variantquestions@myriad.com. -
not provided Benign:1
- -
Hereditary cancer-predisposing syndrome Benign:1
This alteration is classified as benign based on a combination of the following: seen in unaffected individuals, population frequency, intact protein function, lack of segregation with disease, co-occurrence, RNA analysis, in silico models, amino acid conservation, lack of disease association in case-control studies, and/or the mechanism of disease or impacted region is inconsistent with a known cause of pathogenicity. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at