rs1555225627

Variant names:

• chr12-132659279-T-TGGGGGGAGCCCTCACCTCTCCGTGAC
• rs1555225627
• NM_006231.4:c.3265_3275+15dupGTCACGGAGAGGTGAGGGCTCCCCCC

Variant summary

Our verdict is Benign. Variant got -16 ACMG points: 0P and 16B. BP6_Very_Strong BS1 BS2

The NM_006231.4(POLE):​c.3265_3275+15dupGTCACGGAGAGGTGAGGGCTCCCCCC variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0086 in 150,724 control chromosomes in the GnomAD database, including 12 homozygotes. Variant has been reported in ClinVar as Likely benign (★★).

• Frequency:
  • Genomes: 𝑓 0.0086 (12 hom., cov: 33)
  • Exomes 𝑓: 0.00082 (14 hom.)
  • Failed GnomAD Quality Control
• Consequence: POLE NM_006231.4 intron
• Clinical Significance: Benign/Likely benign criteria provided, multiple submitters, no conflicts B:5
• Conservation: PhyloP100: -1.71

Genes affected

POLE (HGNC:9177): (DNA polymerase epsilon, catalytic subunit) This gene encodes the catalytic subunit of DNA polymerase epsilon. The enzyme is involved in DNA repair and chromosomal DNA replication. Mutations in this gene have been associated with colorectal cancer 12 and facial dysmorphism, immunodeficiency, livedo, and short stature. [provided by RefSeq, Sep 2013]

ACMG classification

Verdict is Benign. Variant got -16 ACMG points.

• BP6: Variant 12-132659279-T-TGGGGGGAGCCCTCACCTCTCCGTGAC is Benign according to our data. Variant chr12-132659279-T-TGGGGGGAGCCCTCACCTCTCCGTGAC is described in ClinVar as [Likely_benign]. Clinvar id is 240462.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BS1: Variant frequency is greater than expected in population afr. gnomad4 allele frequency = 0.0086 (1296/150724) while in subpopulation AFR AF= 0.0302 (1239/41010). AF 95% confidence interval is 0.0288. There are 12 homozygotes in gnomad4. There are 614 alleles in male gnomad4 subpopulation. Median coverage is 33. This position pass quality control queck.
• BS2: High Homozygotes in GnomAd4 at 12 AD,AR gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
POLE	NM_006231.4	c.3265_3275+15dupGTCACGGAGAGGTGAGGGCTCCCCCC		intron_variant	Intron 26 of 48	ENST00000320574.10	NP_006222.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
POLE	ENST00000320574.10	c.3275+15_3275+16insGTCACGGAGAGGTGAGGGCTCCCCCC		intron_variant	Intron 26 of 48	1	NM_006231.4	ENSP00000322570.5

Frequencies

GnomAD3 genomes AF: 0.00861 AC: 1296 AN: 150602 Hom.: 12 Cov.: 33

Gnomad AFR AF: 0.0303

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00264

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000888

Gnomad OTH AF: 0.00530

GnomAD3 exomes AF: 0.00190 AC: 468 AN: 246754 Hom.: 1 AF XY: 0.00147 AC XY: 197 AN XY: 133850

Gnomad AFR exome AF: 0.0250

Gnomad AMR exome AF: 0.00189

Gnomad ASJ exome AF: 0.000100

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000362

Gnomad OTH exome AF: 0.000495

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000821 AC: 1196 AN: 1456310 Hom.: 14 Cov.: 32 AF XY: 0.000709 AC XY: 514 AN XY: 724712

Gnomad4 AFR exome AF: 0.0298

Gnomad4 AMR exome AF: 0.00179

Gnomad4 ASJ exome AF: 0.0000384

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.0000349

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.0000135

Gnomad4 OTH exome AF: 0.00165

GnomAD4 genome AF: 0.00860 AC: 1296 AN: 150724 Hom.: 12 Cov.: 33 AF XY: 0.00834 AC XY: 614 AN XY: 73662

Gnomad4 AFR AF: 0.0302

Gnomad4 AMR AF: 0.00263

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000888

Gnomad4 OTH AF: 0.00524

Alfa AF: 0.000305 Hom.: 0

ClinVar

Significance: Benign/Likely benign

Submissions summary: Benign:5

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not specified Benign:2

Mar 04, 2025

Center for Genomic Medicine, Rigshospitalet, Copenhagen University Hospital

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Feb 01, 2018

GeneDx

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant is considered likely benign or benign based on one or more of the following criteria: it is a conservative change, it occurs at a poorly conserved position in the protein, it is predicted to be benign by multiple in silico algorithms, and/or has population frequency not consistent with disease. -

Colorectal cancer, susceptibility to, 12 Benign:1

Jul 11, 2016

Counsyl

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

not provided Benign:1

Feb 03, 2025

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Hereditary cancer-predisposing syndrome Benign:1

Nov 10, 2021

Ambry Genetics

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This alteration is classified as benign based on a combination of the following: seen in unaffected individuals, population frequency, intact protein function, lack of segregation with disease, co-occurrence, RNA analysis, in silico models, amino acid conservation, lack of disease association in case-control studies, and/or the mechanism of disease or impacted region is inconsistent with a known cause of pathogenicity. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555225627; hg19: chr12-133235865;