rs1555229232

Variant names:

• chr12-132675796-CAAACCACCTTTGGATCAGATGAGCCTGAACCCAAGTCACAGCAGTCAGAG-GGTGTAGAAC
• rs1555229232
• ENST00000537064.5:n.*68-26_*92delCTCTGACTGCTGTGACTTGGGTTCAGGCTCATCTGATCCAAAGGTGGTTTGinsGTTCTACACC

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PP3 PP5

The ENST00000537064.5(POLE):​n.*68-26_*92delCTCTGACTGCTGTGACTTGGGTTCAGGCTCATCTGATCCAAAGGTGGTTTGinsGTTCTACACC variant causes a splice region, non coding transcript exon change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).

• Frequency: Genomes: not found (cov: 32)
• Consequence: POLE ENST00000537064.5 splice_region, non_coding_transcript_exon
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications P:1 U:2
• Conservation: PhyloP100: 9.05
• Publications: 0 publications found

Genes affected

POLE (HGNC:9177): (DNA polymerase epsilon, catalytic subunit) This gene encodes the catalytic subunit of DNA polymerase epsilon. The enzyme is involved in DNA repair and chromosomal DNA replication. Mutations in this gene have been associated with colorectal cancer 12 and facial dysmorphism, immunodeficiency, livedo, and short stature. [provided by RefSeq, Sep 2013]

POLE Gene-Disease associations (from GenCC):

• POLE-related polyposis and colorectal cancer syndrome

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• colorectal cancer, susceptibility to, 12

  Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Ambry Genetics
• facial dysmorphism-immunodeficiency-livedo-short stature syndrome

  Inheritance: AR Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Ambry Genetics
• intrauterine growth retardation, metaphyseal dysplasia, adrenal hypoplasia congenita, genital anomalies, and immunodeficiency

  Inheritance: AR Classification: STRONG Submitted by: G2P
• IMAGe syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Polymerase proofreading-related adenomatous polyposis

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 12-132675796-CAAACCACCTTTGGATCAGATGAGCCTGAACCCAAGTCACAGCAGTCAGAG-GGTGTAGAAC is Pathogenic according to our data. Variant chr12-132675796-CAAACCACCTTTGGATCAGATGAGCCTGAACCCAAGTCACAGCAGTCAGAG-GGTGTAGAAC is described in ClinVar as Conflicting_classifications_of_pathogenicity. ClinVar VariationId is 420813.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
POLE	NM_006231.4	c.1021-26_1045delCTCTGACTGCTGTGACTTGGGTTCAGGCTCATCTGATCCAAAGGTGGTTTGinsGTTCTACACC	p.Ala341_Glu349delins???	splice_acceptor_variant, missense_variant, conservative_inframe_deletion, splice_region_variant, intron_variant		ENST00000320574.10	NP_006222.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
POLE	ENST00000320574.10	c.1021-26_1045delCTCTGACTGCTGTGACTTGGGTTCAGGCTCATCTGATCCAAAGGTGGTTTGinsGTTCTACACC	p.Ala341_Glu349delins???	splice_acceptor_variant, missense_variant, conservative_inframe_deletion, splice_region_variant, intron_variant		1	NM_006231.4	ENSP00000322570.5

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Conflicting classifications of pathogenicity

Submissions summary: Pathogenic:1 Uncertain:2

Revision: criteria provided, conflicting classifications

Submissions by phenotype

not provided Pathogenic:1 Uncertain:1

Oct 26, 2023

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant results in the deletion of part of exon 11 (c.1021-26_1045delinsGTTCTACACC) of the POLE gene. It is expected to disrupt RNA splicing. Variants that disrupt the donor or acceptor splice site typically lead to a loss of protein function (PMID: 16199547), and loss-of-function variants in POLE are known to be pathogenic (PMID: 23230001, 25948378, 30503519). This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with POLE-related conditions. ClinVar contains an entry for this variant (Variation ID: 420813). In summary, the currently available evidence indicates that the variant is pathogenic, but additional data are needed to prove that conclusively. Therefore, this variant has been classified as Likely Pathogenic. -

Feb 12, 2018

GeneDx

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This combined deletion and insertion is denoted POLE c.1021-26_1045del51ins10 and consists of a deletion of 51 nucleotides and the addition of 10 nucleotides at the intron/exon boundary of exon 11. The normal sequence, with the bases that are deleted and duplicated in brackets, is agac[del51][insgttctacacc]AACA where the capital letters are exonic and the lower case are intronic. This variant has not, to our knowledge, been published in the literature. This variant removes the canonical splice acceptor site as well as the first 25 nucleotides of exon 11 and is predicted to cause abnormal gene splicing, leading to either an abnormal message that is subject to nonsense-mediated mRNA decay or to an abnormal protein product. However, while missense variants located within the exonuclease domain of the POLE gene have been recognized as an underlying cause of Polymerase Proofreading-Associated Polyposis (PPAP), an autosomal dominant condition associated with polyposis and an increased risk for colon cancer (Palles 2013, Spier 2015), there are no data to support that loss-of-function variants, such as this one, confer the same cancer risks. Smith et al. (2013) identified a POLE frameshift variant in a 26 year old with a history of colorectal cancer, but no information about family history was provided. Based on current evidence, we consider this variant to be of uncertain significance with respect to cancer. A recessive disease associated with POLE has been reported in the literature. In one large consanguineous family, 14 affected relatives with a syndrome called FILS (facial dysmorphism, immunodeficiency, livedo, and short stature) were all found to be homozygous for POLE c.4444+3A>G, a splice variant which results in a small proportion (~10%) of normal POLE transcript (Pachlopnik Schmid 2012). In addition, an unrelated individual with a suspected chromosome instability syndrome was also found to be homozygous for POLE c.4444+3A>G (Thiffault 2015). We cannot assess whether the variant identified in the current patient would cause the same recessive disease. Individuals and family members of reproductive age may choose to consider assessment of potential reproductive risks. -

Hereditary cancer-predisposing syndrome Uncertain:1

May 27, 2025

Ambry Genetics

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.1021-26_1045del51insGTTCTACACC variant spans the canonical acceptor site of coding exon 11 in the POLE gene. This variant results from a deletion of 51 nucleotides and insertion of GTTCTACACC nucleotides at positions c.1021-26 to c.1045. This variant is considered to be rare based on population cohorts in the Genome Aggregation Database (gnomAD). The canonical acceptor site is highly conserved in available vertebrate species. In silico splice site analysis predicts that this alteration will weaken the native splice acceptor site and may result in the creation or strengthening of a novel splice acceptor site. Alterations that disrupt the canonical splice site are expected to cause aberrant splicing, resulting in an abnormal protein or a transcript that is subject to nonsense-mediated mRNA decay. Although biallelic loss of function of POLE has been associated with autosomal recessive POLE deficiency, haploinsufficiency of POLE has not been established as a mechanism of disease for POLE-related polymerase proofreading-associated polyposis (PPAP) and POLE-related CMMRD-like syndrome. Based on the supporting evidence, this variant is expected to be causative of POLE deficiency when present along with a second pathogenic variant on the other allele; however, its clinical significance for PPAP and POLE-related CMMRD-like syndrome is unclear. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.1

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555229232; hg19: chr12-133252382;