rs1555229232

Variant names:

• chr12-132675796-CAAACCACCTTTGGATCAGATGAGCCTGAACCCAAGTCACAGCAGTCAGAG-GGTGTAGAAC
• rs1555229232
• NM_006231.4:c.1021-26_1045delCTCTGACTGCTGTGACTTGGGTTCAGGCTCATCTGATCCAAAGGTGGTTTGinsGTTCTACACC

Variant summary

Our verdict is Likely pathogenic. The variant received 9 ACMG points: 9P and 0B. PVS1 PP5

The NM_006231.4(POLE):​c.1021-26_1045delCTCTGACTGCTGTGACTTGGGTTCAGGCTCATCTGATCCAAAGGTGGTTTGinsGTTCTACACC​(p.Ala341_Glu349delins???) variant causes a splice acceptor, missense, conservative inframe deletion, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). Synonymous variant affecting the same amino acid position (i.e. A341A) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 32)
• Consequence: POLE NM_006231.4 splice_acceptor, missense, conservative_inframe_deletion, splice_region, intron
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications P:1 U:2
• Conservation: PhyloP100: 9.05
• Publications: 0 publications found

Genes affected

POLE (HGNC:9177): (DNA polymerase epsilon, catalytic subunit) This gene encodes the catalytic subunit of DNA polymerase epsilon. The enzyme is involved in DNA repair and chromosomal DNA replication. Mutations in this gene have been associated with colorectal cancer 12 and facial dysmorphism, immunodeficiency, livedo, and short stature. [provided by RefSeq, Sep 2013]

POLE Gene-Disease associations (from GenCC):

• POLE-related polyposis and colorectal cancer syndrome

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• colorectal cancer, susceptibility to, 12

  Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp, Ambry Genetics
• facial dysmorphism-immunodeficiency-livedo-short stature syndrome

  Inheritance: AR Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Ambry Genetics
• intrauterine growth retardation, metaphyseal dysplasia, adrenal hypoplasia congenita, genital anomalies, and immunodeficiency

  Inheritance: AR Classification: STRONG Submitted by: G2P
• IMAGe syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Polymerase proofreading-related adenomatous polyposis

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_pathogenic. The variant received 9 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, LoF is a know mechanism of disease, No cryptic splice site detected. Exon removal results in frameshift change.
• PP5: Variant 12-132675796-CAAACCACCTTTGGATCAGATGAGCCTGAACCCAAGTCACAGCAGTCAGAG-GGTGTAGAAC is Pathogenic according to our data. Variant chr12-132675796-CAAACCACCTTTGGATCAGATGAGCCTGAACCCAAGTCACAGCAGTCAGAG-GGTGTAGAAC is described in ClinVar as Conflicting_classifications_of_pathogenicity. ClinVar VariationId is 420813.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_006231.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	POLE	NM_006231.4	MANE Select	c.1021-26_1045delCTCTGACTGCTGTGACTTGGGTTCAGGCTCATCTGATCCAAAGGTGGTTTGinsGTTCTACACC	p.Ala341_Glu349delins???	splice_acceptor missense conservative_inframe_deletion splice_region intron	N/A	NP_006222.2	Q07864

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	POLE	ENST00000320574.10	TSL:1 MANE Select	c.1021-26_1045delCTCTGACTGCTGTGACTTGGGTTCAGGCTCATCTGATCCAAAGGTGGTTTGinsGTTCTACACC	p.Ala341_Glu349delins???	splice_acceptor missense conservative_inframe_deletion splice_region intron	N/A	ENSP00000322570.5	Q07864
	POLE	ENST00000535270.5	TSL:1	c.940-26_964delCTCTGACTGCTGTGACTTGGGTTCAGGCTCATCTGATCCAAAGGTGGTTTGinsGTTCTACACC	p.Ala314_Glu322delins???	splice_acceptor missense conservative_inframe_deletion splice_region intron	N/A	ENSP00000445753.1	F5H1D6
	POLE	ENST00000537064.5	TSL:1	n.*68-26_*92delCTCTGACTGCTGTGACTTGGGTTCAGGCTCATCTGATCCAAAGGTGGTTTGinsGTTCTACACC		splice_region non_coding_transcript_exon	Exon 11 of 49	ENSP00000442578.1	F5H7E4

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Conflicting classifications of pathogenicity

Revision: criteria provided, conflicting classifications

Pathogenic	VUS	Benign	Condition
1	1	-	not provided (2)
-	1	-	Hereditary cancer-predisposing syndrome (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.1

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555229232; hg19: chr12-133252382;