rs1555230119

Variant names:

• chr11-119278559-CTGAACCCATCGTGGTAGATCCGTTTGATCCTAGAGGGAGTGGCAGCCTGTTGAGGCAAGGAGCAGAGGGAGCTCCCTCCCCAAATTATGATGATGATGATGA-C
• rs1555230119
• NM_005188.4:c.1283_1384del

Variant summary

Our verdict is Uncertain significance. The variant received 5 ACMG points: 5P and 0B. PM1 PM4 PP3

The NM_005188.4(CBL):​c.1283_1384del​(p.Pro428_Glu461del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. P428P) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 32)
• Consequence: CBL NM_005188.4 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 9.60
• Publications: 0 publications found

Genes affected

CBL (HGNC:1541): (Cbl proto-oncogene) This gene is a proto-oncogene that encodes a RING finger E3 ubiquitin ligase. The encoded protein is one of the enzymes required for targeting substrates for degradation by the proteasome. This protein mediates the transfer of ubiquitin from ubiquitin conjugating enzymes (E2) to specific substrates. This protein also contains an N-terminal phosphotyrosine binding domain that allows it to interact with numerous tyrosine-phosphorylated substrates and target them for proteasome degradation. As such it functions as a negative regulator of many signal transduction pathways. This gene has been found to be mutated or translocated in many cancers including acute myeloid leukaemia, and expansion of CGG repeats in the 5' UTR has been associated with Jacobsen syndrome. Mutations in this gene are also the cause of Noonan syndrome-like disorder. [provided by RefSeq, Jul 2016]

CBL Gene-Disease associations (from GenCC):

• CBL-related disorder

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, ClinGen, G2P, Labcorp Genetics (formerly Invitae), Genomics England PanelApp, Ambry Genetics
• juvenile myelomonocytic leukemia

  Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
• Noonan syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 5 ACMG points.

• PM1: In a hotspot region, there are 3 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 0 benign, 18 uncertain in NM_005188.4
• PM4: Nonframeshift variant in NON repetitive region in NM_005188.4.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_005188.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CBL	NM_005188.4	MANE Select	c.1283_1384del	p.Pro428_Glu461del	disruptive_inframe_deletion	Exon 9 of 16	NP_005179.2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CBL	ENST00000264033.6	TSL:1 MANE Select	c.1283_1384del	p.Pro428_Glu461del	disruptive_inframe_deletion	Exon 9 of 16	ENSP00000264033.3	P22681
	CBL	ENST00000634586.1	TSL:5	c.1283_1384del	p.Pro428_Glu461del	disruptive_inframe_deletion	Exon 9 of 18	ENSP00000489218.1	A0A0U1RQX8
	CBL	ENST00000637974.1	TSL:5	c.1277_1378del	p.Pro426_Glu459del	disruptive_inframe_deletion	Exon 9 of 17	ENSP00000490763.1	A0A1B0GW38

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	not specified (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.6

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555230119; hg19: chr11-119149269;