rs1555230119

chr11-119278559-CTGAACCCATCGTGGTAGATCCGTTTGATCCTAGAGGGAGTGGCAGCCTGTTGAGGCAAGGAGCAGAGGGAGCTCCCTCCCCAAATTATGATGATGATGATGA-C

Variant summary

Our verdict is Uncertain significance. Variant got 3 ACMG points: 3P and 0B. PM4 PP3

The NM_005188.4(CBL):c.1283_1384del(p.Pro428_Glu461del) variant causes a inframe deletion change involving the alteration of a conserved nucleotide. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. T426T) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 32)
• Consequence: CBL NM_005188.4 inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 9.60

Genes affected

CBL (HGNC:1541): (Cbl proto-oncogene) This gene is a proto-oncogene that encodes a RING finger E3 ubiquitin ligase. The encoded protein is one of the enzymes required for targeting substrates for degradation by the proteasome. This protein mediates the transfer of ubiquitin from ubiquitin conjugating enzymes (E2) to specific substrates. This protein also contains an N-terminal phosphotyrosine binding domain that allows it to interact with numerous tyrosine-phosphorylated substrates and target them for proteasome degradation. As such it functions as a negative regulator of many signal transduction pathways. This gene has been found to be mutated or translocated in many cancers including acute myeloid leukaemia, and expansion of CGG repeats in the 5' UTR has been associated with Jacobsen syndrome. Mutations in this gene are also the cause of Noonan syndrome-like disorder. [provided by RefSeq, Jul 2016]

ACMG classification

Verdict is Uncertain_significance. Variant got 3 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_005188.4.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	UniProt
CBL	NM_005188.4	c.1283_1384del	p.Pro428_Glu461del	inframe_deletion	9/16	ENST00000264033.6

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Appris	UniProt
CBL	ENST00000264033.6	c.1283_1384del	p.Pro428_Glu461del	inframe_deletion	9/16	1	NM_005188.4	P2

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not specified Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine

May 08, 2015

Variant classified as Uncertain Significance - Favor Pathogenic. The p.Pro428_Gl u461del variant in CBL has not been previously reported in individuals with a RA Sopathy. This variant is a deletion of 33 amino acids at position 428 and is not predicted to alter the protein reading-frame. The region containing the 33 dele ted amino acids is conserved in mammals and across evolutionarily distant specie s, and while this is likely to affect the protein, the impact to protein functio n cannot be fully determined. In addition, other variants in this region have be en reported in individuals with Noonan-like features and/or JMML (Strullu 2013, Martinelli 2010, LMM unpublished data). In summary, while there is some suspicio n for a pathogenic role, the clinical significance of the p.Pro428_Glu461del var iant is uncertain. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555230119; hg19: chr11-119149269;