rs1555282658
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_000059.4(BRCA2):c.2398_2423dupGGTAACAATTATGAATCTGATGTTGA(p.Leu809ValfsTer10) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★★). Synonymous variant affecting the same amino acid position (i.e. E808E) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_000059.4 frameshift
Scores
Clinical Significance
Conservation
Publications
- breast-ovarian cancer, familial, susceptibility to, 2Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Genomics England PanelApp, Labcorp Genetics (formerly Invitae), ClinGen
- Fanconi anemia complementation group D1Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, ClinGen, G2P
- pancreatic cancer, susceptibility to, 2Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
- sarcomaInheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
- hereditary breast ovarian cancer syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Fanconi anemiaInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- medulloblastomaInheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Transcripts
RefSeq
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
BRCA2 | ENST00000380152.8 | c.2398_2423dupGGTAACAATTATGAATCTGATGTTGA | p.Leu809ValfsTer10 | frameshift_variant | Exon 11 of 27 | 5 | NM_000059.4 | ENSP00000369497.3 | ||
BRCA2 | ENST00000530893.7 | c.2029_2054dupGGTAACAATTATGAATCTGATGTTGA | p.Leu686ValfsTer10 | frameshift_variant | Exon 11 of 27 | 1 | ENSP00000499438.2 | |||
BRCA2 | ENST00000614259.2 | n.2398_2423dupGGTAACAATTATGAATCTGATGTTGA | non_coding_transcript_exon_variant | Exon 10 of 26 | 2 | ENSP00000506251.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 exome Cov.: 33
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Breast-ovarian cancer, familial, susceptibility to, 2 Pathogenic:1
Variant allele predicted to encode a truncated non-functional protein. -
Hereditary cancer-predisposing syndrome Pathogenic:1
The c.2398_2423dup26 pathogenic mutation, located in coding exon 10 of the BRCA2 gene, results from a duplication of GGTAACAATTATGAATCTGATGTTGA at nucleotide positions 2398 to 2423, causing a translational frameshift with a predicted alternate stop codon (p.L809Vfs*10). This variant is considered to be rare based on population cohorts in the Genome Aggregation Database (gnomAD). This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation. -
Hereditary breast ovarian cancer syndrome Pathogenic:1
- -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at