rs1555282658
Positions:
Variant summary
Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1PM2PP5_Very_Strong
The NM_000059.4(BRCA2):c.2398_2423dup(p.Leu809ValfsTer10) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★★★). Synonymous variant affecting the same amino acid position (i.e. K799K) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Genomes: not found (cov: 32)
Consequence
BRCA2
NM_000059.4 frameshift
NM_000059.4 frameshift
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 0.457
Genes affected
BRCA2 (HGNC:1101): (BRCA2 DNA repair associated) Inherited mutations in BRCA1 and this gene, BRCA2, confer increased lifetime risk of developing breast or ovarian cancer. Both BRCA1 and BRCA2 are involved in maintenance of genome stability, specifically the homologous recombination pathway for double-strand DNA repair. The largest exon in both genes is exon 11, which harbors the most important and frequent mutations in breast cancer patients. The BRCA2 gene was found on chromosome 13q12.3 in human. The BRCA2 protein contains several copies of a 70 aa motif called the BRC motif, and these motifs mediate binding to the RAD51 recombinase which functions in DNA repair. BRCA2 is considered a tumor suppressor gene, as tumors with BRCA2 mutations generally exhibit loss of heterozygosity (LOH) of the wild-type allele. [provided by RefSeq, May 2020]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Pathogenic. Variant got 18 ACMG points.
PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 13-32336751-A-AAGGTAACAATTATGAATCTGATGTTG is Pathogenic according to our data. Variant chr13-32336751-A-AAGGTAACAATTATGAATCTGATGTTG is described in ClinVar as [Pathogenic]. Clinvar id is 433767.Status of the report is reviewed_by_expert_panel, 3 stars.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | UniProt |
---|---|---|---|---|---|---|---|
BRCA2 | NM_000059.4 | c.2398_2423dup | p.Leu809ValfsTer10 | frameshift_variant | 11/27 | ENST00000380152.8 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|
BRCA2 | ENST00000380152.8 | c.2398_2423dup | p.Leu809ValfsTer10 | frameshift_variant | 11/27 | 5 | NM_000059.4 | A2 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD3 genomes
Cov.:
32
GnomAD4 exome Cov.: 33
GnomAD4 exome
Cov.:
33
GnomAD4 genome Cov.: 32
GnomAD4 genome
Cov.:
32
ClinVar
Significance: Pathogenic
Submissions summary: Pathogenic:3
Revision: reviewed by expert panel
LINK: link
Submissions by phenotype
Breast-ovarian cancer, familial, susceptibility to, 2 Pathogenic:1
Pathogenic, reviewed by expert panel | curation | Evidence-based Network for the Interpretation of Germline Mutant Alleles (ENIGMA) | Dec 15, 2017 | Variant allele predicted to encode a truncated non-functional protein. - |
Hereditary cancer-predisposing syndrome Pathogenic:1
Pathogenic, criteria provided, single submitter | clinical testing | Ambry Genetics | Jan 10, 2023 | The c.2398_2423dup26 pathogenic mutation, located in coding exon 10 of the BRCA2 gene, results from a duplication of GGTAACAATTATGAATCTGATGTTGA at nucleotide positions 2398 to 2423, causing a translational frameshift with a predicted alternate stop codon (p.L809Vfs*10). This variant is considered to be rare based on population cohorts in the Genome Aggregation Database (gnomAD). This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation. - |
Hereditary breast ovarian cancer syndrome Pathogenic:1
Likely pathogenic, criteria provided, single submitter | clinical testing | Department of Pathology and Laboratory Medicine, Sinai Health System | - | - - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at