rs1555283826

Variant names:

• chr13-51937503-GATGGCCACATCCGTGCCGGTGCCA-G
• rs1555283826
• NM_000053.4:c.3852_3875delTGGCACCGGCACGGATGTGGCCAT

Variant summary

Our verdict is Likely pathogenic. The variant received 6 ACMG points: 6P and 0B. PM1 PM4 PP3 PP5

The NM_000053.4(ATP7B):​c.3852_3875delTGGCACCGGCACGGATGTGGCCAT​(p.Gly1285_Ile1292del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00000547 in 1,461,718 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). Synonymous variant affecting the same amino acid position (i.e. I1284I) has been classified as Likely benign.

• Frequency:
  • Genomes: not found (cov: 33)
  • Exomes 𝑓: 0.0000055 (0 hom.)
• Consequence: ATP7B NM_000053.4 disruptive_inframe_deletion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications P:1 U:2
• Conservation: PhyloP100: 9.92
• Publications: 0 publications found

Genes affected

ATP7B (HGNC:870): (ATPase copper transporting beta) This gene is a member of the P-type cation transport ATPase family and encodes a protein with several membrane-spanning domains, an ATPase consensus sequence, a hinge domain, a phosphorylation site, and at least 2 putative copper-binding sites. This protein is a monomer, and functions as a copper-transporting ATPase which exports copper out of the cells, such as the efflux of hepatic copper into the bile. Alternate transcriptional splice variants, encoding different isoforms with distinct cellular localizations, have been characterized. Mutations in this gene have been associated with Wilson disease which is characterized by copper accumulation. [provided by RefSeq, Dec 2019]

ATP7B Gene-Disease associations (from GenCC):

• Wilson disease

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: ClinGen, Genomics England PanelApp, Orphanet, Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Likely_pathogenic. The variant received 6 ACMG points.

• PM1: In a hotspot region, there are 10 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 0 benign, 14 uncertain in NM_000053.4
• PM4: Nonframeshift variant in NON repetitive region in NM_000053.4.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 13-51937503-GATGGCCACATCCGTGCCGGTGCCA-G is Pathogenic according to our data. Variant chr13-51937503-GATGGCCACATCCGTGCCGGTGCCA-G is described in ClinVar as Conflicting_classifications_of_pathogenicity. ClinVar VariationId is 555278.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ATP7B	NM_000053.4	c.3852_3875delTGGCACCGGCACGGATGTGGCCAT	p.Gly1285_Ile1292del	disruptive_inframe_deletion	Exon 18 of 21	ENST00000242839.10	NP_000044.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ATP7B	ENST00000242839.10	c.3852_3875delTGGCACCGGCACGGATGTGGCCAT	p.Gly1285_Ile1292del	disruptive_inframe_deletion	Exon 18 of 21	1	NM_000053.4	ENSP00000242839.5

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome AF: 0.00000547 AC: 8 AN: 1461718 Hom.: 0 AF XY: 0.00000413 AC XY: 3 AN XY: 727146

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.0000299 AC: 1 AN: 33478

American (AMR) AF: 0.00 AC: 0 AN: 44720

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26136

East Asian (EAS) AF: 0.00 AC: 0 AN: 39698

South Asian (SAS) AF: 0.00 AC: 0 AN: 86254

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53324

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5768

European-Non Finnish (NFE) AF: 0.00000630 AC: 7 AN: 1111950

Other (OTH) AF: 0.00 AC: 0 AN: 60390

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.0000000102751), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome Cov.: 33

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.00000378

ClinVar

Significance: Conflicting classifications of pathogenicity

Submissions summary: Pathogenic:1 Uncertain:2

Revision: criteria provided, conflicting classifications

Submissions by phenotype

Wilson disease Pathogenic:1 Uncertain:2

Nov 27, 2017

Counsyl

Significance: Uncertain significance

Review Status: no assertion criteria provided

Collection Method: clinical testing

This submission and the accompanying classification are no longer maintained by the submitter. For more information on current observations and classification, please contact variantquestions@myriad.com. -

Jul 09, 2023

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individual(s) with Wilson's disease (PMID: 9222767). ClinVar contains an entry for this variant (Variation ID: 555278). This variant disrupts a region of the ATP7B protein in which other variant(s) (p.Thr1288Arg) have been determined to be pathogenic (PMID: 16416207, 17410460). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic. This variant, c.3852_3875del, results in the deletion of 8 amino acid(s) of the ATP7B protein (p.Gly1285_Ile1292del), but otherwise preserves the integrity of the reading frame. -

Sep 05, 2021

Genome-Nilou Lab

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.9
Mutation Taster		=1/199	disease causing (long InDel)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555283826; hg19: chr13-52511639;