rs1555283826

Variant names:

• chr13-51937503-GATGGCCACATCCGTGCCGGTGCCA-G
• rs1555283826
• NM_000053.4:c.3852_3875delTGGCACCGGCACGGATGTGGCCAT

Variant summary

Our verdict is Likely pathogenic. The variant received 6 ACMG points: 6P and 0B. PM1 PM4 PP3 PP5

The NM_000053.4(ATP7B):​c.3852_3875delTGGCACCGGCACGGATGTGGCCAT​(p.Gly1285_Ile1292del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00000547 in 1,461,718 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). Synonymous variant affecting the same amino acid position (i.e. I1284I) has been classified as Likely benign.

• Frequency:
  • Genomes: not found (cov: 33)
  • Exomes 𝑓: 0.0000055 (0 hom.)
• Consequence: ATP7B NM_000053.4 disruptive_inframe_deletion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications P:1 U:2
• Conservation: PhyloP100: 9.92
• Publications: 0 publications found

Genes affected

ATP7B (HGNC:870): (ATPase copper transporting beta) This gene is a member of the P-type cation transport ATPase family and encodes a protein with several membrane-spanning domains, an ATPase consensus sequence, a hinge domain, a phosphorylation site, and at least 2 putative copper-binding sites. This protein is a monomer, and functions as a copper-transporting ATPase which exports copper out of the cells, such as the efflux of hepatic copper into the bile. Alternate transcriptional splice variants, encoding different isoforms with distinct cellular localizations, have been characterized. Mutations in this gene have been associated with Wilson disease which is characterized by copper accumulation. [provided by RefSeq, Dec 2019]

ATP7B Gene-Disease associations (from GenCC):

• Wilson disease

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: ClinGen, Orphanet, Genomics England PanelApp, Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Likely_pathogenic. The variant received 6 ACMG points.

• PM1: In a hotspot region, there are 11 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 0 benign, 15 uncertain in NM_000053.4
• PM4: Nonframeshift variant in NON repetitive region in NM_000053.4.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 13-51937503-GATGGCCACATCCGTGCCGGTGCCA-G is Pathogenic according to our data. Variant chr13-51937503-GATGGCCACATCCGTGCCGGTGCCA-G is described in ClinVar as Conflicting_classifications_of_pathogenicity. ClinVar VariationId is 555278.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000053.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ATP7B	NM_000053.4	MANE Select	c.3852_3875delTGGCACCGGCACGGATGTGGCCAT	p.Gly1285_Ile1292del	disruptive_inframe_deletion	Exon 18 of 21	NP_000044.2	P35670-1
	ATP7B	NM_001406511.1		c.3852_3875delTGGCACCGGCACGGATGTGGCCAT	p.Gly1285_Ile1292del	disruptive_inframe_deletion	Exon 19 of 22	NP_001393440.1	P35670-1
	ATP7B	NM_001406512.1		c.3852_3875delTGGCACCGGCACGGATGTGGCCAT	p.Gly1285_Ile1292del	disruptive_inframe_deletion	Exon 19 of 22	NP_001393441.1	P35670-1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ATP7B	ENST00000242839.10	TSL:1 MANE Select	c.3852_3875delTGGCACCGGCACGGATGTGGCCAT	p.Gly1285_Ile1292del	disruptive_inframe_deletion	Exon 18 of 21	ENSP00000242839.5	P35670-1
	ATP7B	ENST00000634844.1	TSL:1	c.3708_3731delTGGCACCGGCACGGATGTGGCCAT	p.Gly1237_Ile1244del	disruptive_inframe_deletion	Exon 18 of 21	ENSP00000489398.1	B7ZLR4
	ATP7B	ENST00000418097.7	TSL:1	c.3657_3680delTGGCACCGGCACGGATGTGGCCAT	p.Gly1220_Ile1227del	disruptive_inframe_deletion	Exon 17 of 20	ENSP00000393343.2	F5H748

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome AF: 0.00000547 AC: 8 AN: 1461718 Hom.: 0 AF XY: 0.00000413 AC XY: 3 AN XY: 727146

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.0000299 AC: 1 AN: 33478

American (AMR) AF: 0.00 AC: 0 AN: 44720

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26136

East Asian (EAS) AF: 0.00 AC: 0 AN: 39698

South Asian (SAS) AF: 0.00 AC: 0 AN: 86254

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53324

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5768

European-Non Finnish (NFE) AF: 0.00000630 AC: 7 AN: 1111950

Other (OTH) AF: 0.00 AC: 0 AN: 60390

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.0000000102751), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome Cov.: 33

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.00000378

ClinVar

ClinVar submissions

Significance: Conflicting classifications of pathogenicity

Revision: criteria provided, conflicting classifications

Pathogenic	VUS	Benign	Condition
1	2	-	Wilson disease (3)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.9
Mutation Taster		=1/199	disease causing (long InDel)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555283826; hg19: chr13-52511639;