rs1555283826

Positions:

• chr13-51937503-GATGGCCACATCCGTGCCGGTGCCA-G

Variant summary

Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PM2 PM4 PP3 PP5

The NM_000053.4(ATP7B):​c.3852_3875delTGGCACCGGCACGGATGTGGCCAT​(p.Gly1285_Ile1292del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00000547 in 1,461,718 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).

• Frequency:
  • Genomes: not found (cov: 33)
  • Exomes 𝑓: 0.0000055 (0 hom.)
• Consequence: ATP7B NM_000053.4 disruptive_inframe_deletion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications P:1 U:2
• Conservation: PhyloP100: 9.92

Genes affected

ATP7B (HGNC:870): (ATPase copper transporting beta) This gene is a member of the P-type cation transport ATPase family and encodes a protein with several membrane-spanning domains, an ATPase consensus sequence, a hinge domain, a phosphorylation site, and at least 2 putative copper-binding sites. This protein is a monomer, and functions as a copper-transporting ATPase which exports copper out of the cells, such as the efflux of hepatic copper into the bile. Alternate transcriptional splice variants, encoding different isoforms with distinct cellular localizations, have been characterized. Mutations in this gene have been associated with Wilson disease which is characterized by copper accumulation. [provided by RefSeq, Dec 2019]

ATP7B (HGNC:):

ACMG classification

Verdict is Likely_pathogenic. Variant got 6 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_000053.4.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 13-51937503-GATGGCCACATCCGTGCCGGTGCCA-G is Pathogenic according to our data. Variant chr13-51937503-GATGGCCACATCCGTGCCGGTGCCA-G is described in ClinVar as [Conflicting_classifications_of_pathogenicity]. Clinvar id is 555278.We mark this variant Likely_pathogenic, oryginal submissions are: {Uncertain_significance=2, Pathogenic=1}.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
ATP7B	NM_000053.4	c.3852_3875delTGGCACCGGCACGGATGTGGCCAT	p.Gly1285_Ile1292del	disruptive_inframe_deletion	18/21	ENST00000242839.10	NP_000044.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
ATP7B	ENST00000242839.10	c.3852_3875delTGGCACCGGCACGGATGTGGCCAT	p.Gly1285_Ile1292del	disruptive_inframe_deletion	18/21	1	NM_000053.4	ENSP00000242839.5

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome AF: 0.00000547 AC: 8 AN: 1461718 Hom.: 0 AF XY: 0.00000413 AC XY: 3 AN XY: 727146

Gnomad4 AFR exome AF: 0.0000299

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000630

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 33

Bravo AF: 0.00000378

ClinVar

Significance: Conflicting classifications of pathogenicity

Submissions summary: Pathogenic:1 Uncertain:2

Revision: criteria provided, conflicting classifications

Submissions by phenotype

Wilson disease Pathogenic:1 Uncertain:2

Uncertain significance, criteria provided, single submitter	clinical testing	Genome-Nilou Lab	Sep 05, 2021	- -
Pathogenic, criteria provided, single submitter	clinical testing	Labcorp Genetics (formerly Invitae), Labcorp	Jul 09, 2023	This variant, c.3852_3875del, results in the deletion of 8 amino acid(s) of the ATP7B protein (p.Gly1285_Ile1292del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individual(s) with Wilson's disease (PMID: 9222767). ClinVar contains an entry for this variant (Variation ID: 555278). This variant disrupts a region of the ATP7B protein in which other variant(s) (p.Thr1288Arg) have been determined to be pathogenic (PMID: 16416207, 17410460). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic. -
Uncertain significance, criteria provided, single submitter	clinical testing	Counsyl	Nov 27, 2017	- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555283826; hg19: chr13-52511639;