rs1555396783
Variant summary
Our verdict is Likely pathogenic. The variant received 6 ACMG points: 6P and 0B. PM1PM4PP3PP5
The NM_000138.5(FBN1):c.5074_5097delAGAAGTTTGTGCTACAGAAACTAC(p.Arg1692_Tyr1699del) variant causes a conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars). Synonymous variant affecting the same amino acid position (i.e. R1692R) has been classified as Likely benign. The gene FBN1 is included in the ClinGen Criteria Specification Registry.
Frequency
Consequence
NM_000138.5 conservative_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- Marfan syndromeInheritance: AD, AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: ClinGen, G2P, Labcorp Genetics (formerly Invitae), Genomics England PanelApp, Orphanet, Ambry Genetics
- familial thoracic aortic aneurysm and aortic dissectionInheritance: Unknown, AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
- Acromicric dysplasiaInheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Ambry Genetics, Orphanet
- progeroid and marfanoid aspect-lipodystrophy syndromeInheritance: AD Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), Orphanet
- stiff skin syndromeInheritance: AD Classification: STRONG, LIMITED Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)
- Weill-Marchesani syndrome 2, dominantInheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P
- geleophysic dysplasiaInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- isolated ectopia lentisInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- neonatal Marfan syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Weill-Marchesani syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- ectopia lentis 1, isolated, autosomal dominantInheritance: AD Classification: LIMITED Submitted by: G2P
- Shprintzen-Goldberg syndromeInheritance: Unknown, AD Classification: LIMITED, NO_KNOWN Submitted by: Labcorp Genetics (formerly Invitae), ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 6 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000138.5. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| FBN1 | MANE Select | c.5074_5097delAGAAGTTTGTGCTACAGAAACTAC | p.Arg1692_Tyr1699del | conservative_inframe_deletion | Exon 42 of 66 | NP_000129.3 | |||
| FBN1 | c.5074_5097delAGAAGTTTGTGCTACAGAAACTAC | p.Arg1692_Tyr1699del | conservative_inframe_deletion | Exon 41 of 65 | NP_001393645.1 | P35555 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| FBN1 | TSL:1 MANE Select | c.5074_5097delAGAAGTTTGTGCTACAGAAACTAC | p.Arg1692_Tyr1699del | conservative_inframe_deletion | Exon 42 of 66 | ENSP00000325527.5 | P35555 | ||
| FBN1 | TSL:1 | n.5074_5097delAGAAGTTTGTGCTACAGAAACTAC | non_coding_transcript_exon | Exon 42 of 67 | ENSP00000453958.2 | H0YND0 | |||
| FBN1 | TSL:5 | n.*837_*860delAGAAGTTTGTGCTACAGAAACTAC | non_coding_transcript_exon | Exon 17 of 31 | ENSP00000440294.2 | F6U495 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 genome Cov.: 33
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.