rs1555396783

Positions:

• chr15-48463208-AGTAGTTTCTGTAGCACAAACTTCT-A

Variant summary

Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PM2 PM4 PP3 PP5

The NM_000138.5(FBN1):​c.5074_5097delAGAAGTTTGTGCTACAGAAACTAC​(p.Arg1692_Tyr1699del) variant causes a conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (no stars).

• Frequency: Genomes: not found (cov: 33)
• Consequence: FBN1 NM_000138.5 conservative_inframe_deletion
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 9.32

Genes affected

FBN1 (HGNC:3603): (fibrillin 1) This gene encodes a member of the fibrillin family of proteins. The encoded preproprotein is proteolytically processed to generate two proteins including the extracellular matrix component fibrillin-1 and the protein hormone asprosin. Fibrillin-1 is an extracellular matrix glycoprotein that serves as a structural component of calcium-binding microfibrils. These microfibrils provide force-bearing structural support in elastic and nonelastic connective tissue throughout the body. Asprosin, secreted by white adipose tissue, has been shown to regulate glucose homeostasis. Mutations in this gene are associated with Marfan syndrome and the related MASS phenotype, as well as ectopia lentis syndrome, Weill-Marchesani syndrome, Shprintzen-Goldberg syndrome and neonatal progeroid syndrome. [provided by RefSeq, Apr 2016]

FBN1 (HGNC:):

ACMG classification

Verdict is Likely_pathogenic. Variant got 6 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_000138.5.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 15-48463208-AGTAGTTTCTGTAGCACAAACTTCT-A is Pathogenic according to our data. Variant chr15-48463208-AGTAGTTTCTGTAGCACAAACTTCT-A is described in ClinVar as [Pathogenic]. Clinvar id is 16459.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
FBN1	NM_000138.5	c.5074_5097delAGAAGTTTGTGCTACAGAAACTAC	p.Arg1692_Tyr1699del	conservative_inframe_deletion	42/66	ENST00000316623.10	NP_000129.3
FBN1	NM_001406716.1	c.5074_5097delAGAAGTTTGTGCTACAGAAACTAC	p.Arg1692_Tyr1699del	conservative_inframe_deletion	41/65		NP_001393645.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
FBN1	ENST00000316623.10	c.5074_5097delAGAAGTTTGTGCTACAGAAACTAC	p.Arg1692_Tyr1699del	conservative_inframe_deletion	42/66	1	NM_000138.5	ENSP00000325527.5

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Weill-Marchesani syndrome 2, dominant Pathogenic:1

Pathogenic, no assertion criteria provided

literature only

OMIM

Jan 01, 2003

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555396783; hg19: chr15-48755405;