rs1555405428

Variant names:

• chr15-40418218-GAGGCGGCTGGTCATCGGCAGAGCCTTCA-G
• rs1555405428
• NM_002225.5:c.1229_1256delGGCGGCTGGTCATCGGCAGAGCCTTCAA

Variant summary

Our verdict is Likely pathogenic. The variant received 6 ACMG points: 6P and 0B. PVS1_Strong PP5_Moderate

The NM_002225.5(IVD):​c.1229_1256delGGCGGCTGGTCATCGGCAGAGCCTTCAA​(p.Arg410MetfsTer24) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: IVD NM_002225.5 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:2
• Conservation: PhyloP100: 10.0
• Publications: 0 publications found

Genes affected

IVD (HGNC:6186): (isovaleryl-CoA dehydrogenase) Isovaleryl-CoA dehydrogenase (IVD) is a mitochondrial matrix enzyme that catalyzes the third step in leucine catabolism. The genetic deficiency of IVD results in an accumulation of isovaleric acid, which is toxic to the central nervous system and leads to isovaleric acidemia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2017]

IVD Gene-Disease associations (from GenCC):

• isovaleric acidemia

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: G2P, ClinGen, Myriad Women's Health, Labcorp Genetics (formerly Invitae), Orphanet

ACMG classification

Our verdict: Likely_pathogenic. The variant received 6 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. There are 5 pathogenic variants in the truncated region.
• PP5: Variant 15-40418218-GAGGCGGCTGGTCATCGGCAGAGCCTTCA-G is Pathogenic according to our data. Variant chr15-40418218-GAGGCGGCTGGTCATCGGCAGAGCCTTCA-G is described in ClinVar as Pathogenic. ClinVar VariationId is 551276.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_002225.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	IVD	NM_002225.5	MANE Select	c.1229_1256delGGCGGCTGGTCATCGGCAGAGCCTTCAA	p.Arg410MetfsTer24	frameshift	Exon 12 of 12	NP_002216.3	A0A0A0MT83
	IVD	NM_001354599.3		c.1316_1343delGGCGGCTGGTCATCGGCAGAGCCTTCAA	p.Arg439MetfsTer24	frameshift	Exon 12 of 12	NP_001341528.2
	IVD	NM_001354597.3		c.1181_1208delGGCGGCTGGTCATCGGCAGAGCCTTCAA	p.Arg394MetfsTer24	frameshift	Exon 12 of 12	NP_001341526.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	IVD	ENST00000487418.8	TSL:1 MANE Select	c.1229_1256delGGCGGCTGGTCATCGGCAGAGCCTTCAA	p.Arg410MetfsTer24	frameshift	Exon 12 of 12	ENSP00000418397.3	A0A0A0MT83
	IVD	ENST00000479013.7	TSL:1	c.1139_1166delGGCGGCTGGTCATCGGCAGAGCCTTCAA	p.Arg380MetfsTer24	frameshift	Exon 11 of 11	ENSP00000417990.3	A0A0S2Z4K7
	IVD	ENST00000497816.1	TSL:1	n.606_633delGGCGGCTGGTCATCGGCAGAGCCTTCAA		non_coding_transcript_exon	Exon 4 of 4

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
2	-	-	Isovaleryl-CoA dehydrogenase deficiency (2)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		10

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.

Other links and lift over

dbSNP: rs1555405428;

hg19: chr15-40710417;