rs1555405428

Positions:

• chr15-40418218-GAGGCGGCTGGTCATCGGCAGAGCCTTCA-G

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1_Moderate PM2 PP5_Very_Strong

The NM_002225.5(IVD):​c.1229_1256delGGCGGCTGGTCATCGGCAGAGCCTTCAA​(p.Arg410fs) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: IVD NM_002225.5 frameshift
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:2
• Conservation: PhyloP100: 10.0

Genes affected

IVD (HGNC:6186): (isovaleryl-CoA dehydrogenase) Isovaleryl-CoA dehydrogenase (IVD) is a mitochondrial matrix enzyme that catalyzes the third step in leucine catabolism. The genetic deficiency of IVD results in an accumulation of isovaleric acid, which is toxic to the central nervous system and leads to isovaleric acidemia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2017]

IVD (HGNC:):

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.0338 CDS is truncated, and there are 1 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 15-40418218-GAGGCGGCTGGTCATCGGCAGAGCCTTCA-G is Pathogenic according to our data. Variant chr15-40418218-GAGGCGGCTGGTCATCGGCAGAGCCTTCA-G is described in ClinVar as [Likely_pathogenic]. Clinvar id is 551276.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
IVD	NM_002225.5	c.1229_1256delGGCGGCTGGTCATCGGCAGAGCCTTCAA	p.Arg410fs	frameshift_variant	12/12	ENST00000487418.8	NP_002216.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
IVD	ENST00000487418.8	c.1229_1256delGGCGGCTGGTCATCGGCAGAGCCTTCAA	p.Arg410fs	frameshift_variant	12/12	1	NM_002225.5	ENSP00000418397.3

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic/Likely pathogenic

Submissions summary: Pathogenic:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Isovaleryl-CoA dehydrogenase deficiency Pathogenic:2

Pathogenic, criteria provided, single submitter	clinical testing	Labcorp Genetics (formerly Invitae), Labcorp	Dec 09, 2023	This sequence change results in a frameshift in the IVD gene (p.Arg413Metfs*24). While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 14 amino acid(s) of the IVD protein and extend the protein by 9 additional amino acid residues. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with IVD-related conditions. ClinVar contains an entry for this variant (Variation ID: 551276). This variant disrupts a region of the IVD protein in which other variant(s) (p.Arg414Trp) have been determined to be pathogenic (PMID: 25220015; Invitae). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic. -
Likely pathogenic, criteria provided, single submitter	clinical testing	Counsyl	Mar 28, 2017	- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555405428; hg19: chr15-40710417;