rs1555460399

Variant names:

• chr16-23629819-AACTGTCGAATTGTTTAGTATCACTGGCAAG-A
• rs1555460399
• NM_024675.4:c.2305_2334delCTTGCCAGTGATACTAAACAATTCGACAGT

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_024675.4(PALB2):​c.2305_2334delCTTGCCAGTGATACTAAACAATTCGACAGT​(p.Leu769_Ser778del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). The gene PALB2 is included in the ClinGen Criteria Specification Registry.

• Frequency: Genomes: not found (cov: 32)
• Consequence: PALB2 NM_024675.4 conservative_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:2
• Conservation: PhyloP100: 0.324
• Publications: 1 publications found

Genes affected

PALB2 (HGNC:26144): (partner and localizer of BRCA2) This gene encodes a protein that may function in tumor suppression. This protein binds to and colocalizes with the breast cancer 2 early onset protein (BRCA2) in nuclear foci and likely permits the stable intranuclear localization and accumulation of BRCA2. [provided by RefSeq, Jul 2008]

PALB2 Gene-Disease associations (from GenCC):

• hereditary breast carcinoma

  Inheritance: AD Classification: DEFINITIVE Submitted by: Ambry Genetics
• PALB2-related cancer predisposition

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• Fanconi anemia complementation group N

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), ClinGen, G2P
• pancreatic cancer, susceptibility to, 3

  Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp
• Fanconi anemia

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Specifications for PALB2 are available in the ClinGen Criteria Specification Registry and recommended for reference when assigning criteria.

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_024675.4.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_024675.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PALB2	NM_024675.4	MANE Select	c.2305_2334delCTTGCCAGTGATACTAAACAATTCGACAGT	p.Leu769_Ser778del	conservative_inframe_deletion	Exon 5 of 13	NP_078951.2
	PALB2	NM_001407296.1		c.2245_2274delCTTGCCAGTGATACTAAACAATTCGACAGT	p.Leu749_Ser758del	conservative_inframe_deletion	Exon 4 of 12	NP_001394225.1
	PALB2	NM_001407297.1		c.2305_2334delCTTGCCAGTGATACTAAACAATTCGACAGT	p.Leu769_Ser778del	conservative_inframe_deletion	Exon 5 of 12	NP_001394226.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PALB2	ENST00000261584.9	TSL:1 MANE Select	c.2305_2334delCTTGCCAGTGATACTAAACAATTCGACAGT	p.Leu769_Ser778del	conservative_inframe_deletion	Exon 5 of 13	ENSP00000261584.4	Q86YC2
	PALB2	ENST00000568219.5	TSL:1	c.1420_1449delCTTGCCAGTGATACTAAACAATTCGACAGT	p.Leu474_Ser483del	conservative_inframe_deletion	Exon 5 of 13	ENSP00000454703.2	H3BN63
	PALB2	ENST00000561514.3	TSL:5	c.2311_2340delCTTGCCAGTGATACTAAACAATTCGACAGT	p.Leu771_Ser780del	conservative_inframe_deletion	Exon 5 of 13	ENSP00000460666.3	A0AA52I2C1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	Familial cancer of breast (1)
-	1	-	Hereditary cancer-predisposing syndrome (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.32

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.

Other links and lift over

dbSNP: rs1555460399; hg19: chr16-23641140;