rs1555460399

Positions:

• chr16-23629819-AACTGTCGAATTGTTTAGTATCACTGGCAAG-A

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2 PM4

The NM_024675.4(PALB2):​c.2305_2334delCTTGCCAGTGATACTAAACAATTCGACAGT​(p.Leu769_Ser778del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: PALB2 NM_024675.4 conservative_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:2
• Conservation: PhyloP100: 0.324

Genes affected

PALB2 (HGNC:26144): (partner and localizer of BRCA2) This gene encodes a protein that may function in tumor suppression. This protein binds to and colocalizes with the breast cancer 2 early onset protein (BRCA2) in nuclear foci and likely permits the stable intranuclear localization and accumulation of BRCA2. [provided by RefSeq, Jul 2008]

PALB2 (HGNC:):

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_024675.4.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
PALB2	NM_024675.4	c.2305_2334delCTTGCCAGTGATACTAAACAATTCGACAGT	p.Leu769_Ser778del	conservative_inframe_deletion	5/13	ENST00000261584.9	NP_078951.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
PALB2	ENST00000261584.9	c.2305_2334delCTTGCCAGTGATACTAAACAATTCGACAGT	p.Leu769_Ser778del	conservative_inframe_deletion	5/13	1	NM_024675.4	ENSP00000261584.4

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Hereditary cancer-predisposing syndrome Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Color Diagnostics, LLC DBA Color Health

Jul 29, 2021

This variant deletes 30 nucleotides in the PALB2 gene, causing an in-frame deletion of 10 amino acids in the variant PALB2 protein. To our knowledge, functional studies have not been reported for this variant. This variant has not been reported in individuals affected with hereditary cancer in the literature. This variant has not been identified in the general population by the Genome Aggregation Database (gnomAD). The available evidence is insufficient to determine the role of this variant in disease conclusively. Therefore, this variant is classified as a Variant of Uncertain Significance. -

Familial cancer of breast Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Counsyl

Apr 24, 2018

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555460399; hg19: chr16-23641140;