rs1555508993

Variant names:

• chr16-16163195-GAGAAGGATGGATGGGAGAGGGAAGAGGAGAAGCCA-TCT
• rs1555508993
• NM_001171.6:c.3307-38_3307-3delTGGCTTCTCCTCTTCCCTCTCCCATCCATCCTTCTCinsAGA

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_001171.6(ABCC6):​c.3307-38_3307-3delTGGCTTCTCCTCTTCCCTCTCCCATCCATCCTTCTCinsAGA variant causes a splice region, intron change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (no stars).

• Frequency: Genomes: not found (cov: 32)
• Consequence: ABCC6 NM_001171.6 splice_region, intron
• Clinical Significance: Uncertain significance no assertion criteria provided U:1
• Conservation: PhyloP100: 4.51
• Publications: 0 publications found

Genes affected

ABCC6 (HGNC:57): (ATP binding cassette subfamily C member 6) The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). The encoded protein, a member of the MRP subfamily, is involved in multi-drug resistance. Mutations in this gene cause pseudoxanthoma elasticum. Alternatively spliced transcript variants that encode different proteins have been described for this gene. [provided by RefSeq, Jul 2008]

ABCC6 Gene-Disease associations (from GenCC):

• arterial calcification, generalized, of infancy, 2

  Inheritance: AR Classification: DEFINITIVE Submitted by: G2P
• autosomal recessive inherited pseudoxanthoma elasticum

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), G2P, Laboratory for Molecular Medicine, Orphanet
• inherited pseudoxanthoma elasticum

  Inheritance: SD Classification: DEFINITIVE Submitted by: ClinGen
• arterial calcification of infancy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001171.6. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ABCC6	NM_001171.6	MANE Select	c.3307-38_3307-3delTGGCTTCTCCTCTTCCCTCTCCCATCCATCCTTCTCinsAGA		splice_region intron	N/A	NP_001162.5
	ABCC6	NM_001440309.1		c.3274-38_3274-3delTGGCTTCTCCTCTTCCCTCTCCCATCCATCCTTCTCinsAGA		splice_region intron	N/A	NP_001427238.1
	ABCC6	NM_001440310.1		c.3139-38_3139-3delTGGCTTCTCCTCTTCCCTCTCCCATCCATCCTTCTCinsAGA		splice_region intron	N/A	NP_001427239.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ABCC6	ENST00000205557.12	TSL:1 MANE Select	c.3307-38_3307-3delTGGCTTCTCCTCTTCCCTCTCCCATCCATCCTTCTCinsAGA		splice_region intron	N/A	ENSP00000205557.7	O95255-1
	ABCC6	ENST00000909083.1		c.3403-38_3403-3delTGGCTTCTCCTCTTCCCTCTCCCATCCATCCTTCTCinsAGA		splice_region intron	N/A	ENSP00000579142.1
	ABCC6	ENST00000909090.1		c.3400-38_3400-3delTGGCTTCTCCTCTTCCCTCTCCCATCCATCCTTCTCinsAGA		splice_region intron	N/A	ENSP00000579149.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: no assertion criteria provided

Pathogenic	VUS	Benign	Condition
-	1	-	Autosomal recessive inherited pseudoxanthoma elasticum (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.5

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555508993; hg19: chr16-16257052;