rs1555514052

Variant names:

• chr16-2084361-A-AGCCCCTGAGCAAGTCCAGCTCCTCTCC
• rs1555514052
• NM_000548.5:c.4140_4166dupGCCCCTGAGCAAGTCCAGCTCCTCTCC

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_000548.5(TSC2):​c.4140_4166dupGCCCCTGAGCAAGTCCAGCTCCTCTCC​(p.Pro1389_Glu1390insProLeuSerLysSerSerSerSerPro) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★). Synonymous variant affecting the same amino acid position (i.e. P1389P) has been classified as Likely benign.

• Frequency:
  • Genomes: not found (cov: 33)
  • Exomes 𝑓: 0.0000014 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: TSC2 NM_000548.5 disruptive_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:2
• Conservation: PhyloP100: 2.82
• Publications: 0 publications found

Genes affected

TSC2 (HGNC:12363): (TSC complex subunit 2) This gene is a tumor suppressor gene that encodes the growth inhibitory protein tuberin. Tuberin interacts with hamartin to form the TSC protein complex which functions in the control of cell growth. This TSC protein complex negatively regulates mammalian target of rapamycin complex 1 (mTORC1) signaling which is a major regulator of anabolic cell growth. Mutations in this gene have been associated with tuberous sclerosis and lymphangioleiomyomatosis. [provided by RefSeq, May 2022]

TSC2 Gene-Disease associations (from GenCC):

• tuberous sclerosis

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• tuberous sclerosis 2

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: PanelApp Australia, Laboratory for Molecular Medicine, Labcorp Genetics (formerly Invitae), G2P, Genomics England PanelApp, Ambry Genetics
• lymphangioleiomyomatosis

  Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
• tuberous sclerosis complex

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_000548.5.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
TSC2	NM_000548.5	c.4140_4166dupGCCCCTGAGCAAGTCCAGCTCCTCTCC	p.Pro1389_Glu1390insProLeuSerLysSerSerSerSerPro	disruptive_inframe_insertion	Exon 34 of 42	ENST00000219476.9	NP_000539.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
TSC2	ENST00000219476.9	c.4140_4166dupGCCCCTGAGCAAGTCCAGCTCCTCTCC	p.Pro1389_Glu1390insProLeuSerLysSerSerSerSerPro	disruptive_inframe_insertion	Exon 34 of 42	5	NM_000548.5	ENSP00000219476.3

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000137 AC: 2 AN: 1460316 Hom.: 0 Cov.: 33 AF XY: 0.00000275 AC XY: 2 AN XY: 726468

African (AFR) AF: 0.00 AC: 0 AN: 33474

American (AMR) AF: 0.00 AC: 0 AN: 44716

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26128

East Asian (EAS) AF: 0.00 AC: 0 AN: 39698

South Asian (SAS) AF: 0.00 AC: 0 AN: 86226

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 51980

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5768

European-Non Finnish (NFE) AF: 0.00000180 AC: 2 AN: 1111952

Other (OTH) AF: 0.00 AC: 0 AN: 60374

GnomAD4 genome Cov.: 33

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.00000378

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Tuberous sclerosis 2 Uncertain:1

Oct 11, 2023

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.4140_4166dup, results in the insertion of 9 amino acid(s) of the TSC2 protein (p.Pro1381_Pro1389dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with TSC2-related conditions. ClinVar contains an entry for this variant (Variation ID: 535853). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Hereditary cancer-predisposing syndrome Uncertain:1

Nov 16, 2023

Ambry Genetics

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.4140_4166dup27 variant (also known as p.P1381_P1389dup), located in coding exon 33 of the TSC2 gene, results from an in-frame duplication of 27 nucleotides at nucleotide positions 4140 to 4166. This results in the duplication of 9 extra residues (PLSKSSSSP) between codons 1381 and 1389. This amino acid region is well conserved in available vertebrate species. In addition, this alteration is predicted to be neutral by in silico analysis (Choi Y et al. PLoS ONE. 2012; 7(10):e46688). Since supporting evidence is limited at this time, the clinical significance of this alteration remains unclear. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.8

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555514052; hg19: chr16-2134362;