rs1555516191
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_004360.5(CDH1):c.1553_1565+39delAACAGAAAATAACGTAAGTGTGAGGATTTTTCAACTGACTTGCAGCAACTGG(p.Glu518ArgfsTer23) variant causes a frameshift, splice donor, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. E518E) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_004360.5 frameshift, splice_donor, splice_region, intron
Scores
Clinical Significance
Conservation
Publications
- blepharocheilodontic syndrome 1Inheritance: AD Classification: DEFINITIVE, STRONG, MODERATE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), G2P, Illumina
- CDH1-related diffuse gastric and lobular breast cancer syndromeInheritance: AD Classification: DEFINITIVE, STRONG Submitted by: ClinGen, Labcorp Genetics (formerly Invitae), G2P
- hereditary breast carcinomaInheritance: AD Classification: DEFINITIVE Submitted by: Ambry Genetics
- hereditary diffuse gastric adenocarcinomaInheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, Ambry Genetics
- cleft soft palateInheritance: AD Classification: MODERATE Submitted by: Ambry Genetics
- orofacial cleft 3Inheritance: AD Classification: MODERATE Submitted by: Ambry Genetics
- blepharocheilodontic syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- familial ovarian cancerInheritance: Unknown Classification: NO_KNOWN Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_004360.5. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CDH1 | MANE Select | c.1553_1565+39delAACAGAAAATAACGTAAGTGTGAGGATTTTTCAACTGACTTGCAGCAACTGG | p.Glu518ArgfsTer23 | frameshift splice_donor splice_region intron | Exon 10 of 16 | NP_004351.1 | A0A0U2ZQU7 | ||
| CDH1 | c.-267_-255+39delAACAGAAAATAACGTAAGTGTGAGGATTTTTCAACTGACTTGCAGCAACTGG | splice_region | Exon 10 of 15 | NP_001304115.1 | |||||
| CDH1 | c.1370_1382+39delAACAGAAAATAACGTAAGTGTGAGGATTTTTCAACTGACTTGCAGCAACTGG | p.Glu457ArgfsTer23 | frameshift splice_donor splice_region intron | Exon 9 of 15 | NP_001304113.1 | P12830-2 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CDH1 | TSL:1 MANE Select | c.1550_1565+36delTGGAACAGAAAATAACGTAAGTGTGAGGATTTTTCAACTGACTTGCAGCAAC | p.Met517ArgfsTer23 | frameshift splice_donor splice_region intron | Exon 10 of 16 | ENSP00000261769.4 | P12830-1 | ||
| CDH1 | TSL:1 | c.1367_1382+36delTGGAACAGAAAATAACGTAAGTGTGAGGATTTTTCAACTGACTTGCAGCAAC | p.Met456ArgfsTer23 | frameshift splice_donor splice_region intron | Exon 9 of 15 | ENSP00000414946.2 | P12830-2 | ||
| CDH1 | TSL:1 | n.1621_1636+36delTGGAACAGAAAATAACGTAAGTGTGAGGATTTTTCAACTGACTTGCAGCAAC | splice_donor splice_region intron non_coding_transcript_exon | Exon 9 of 15 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at