rs1555516191

Variant names:

• chr16-68815743-ATGGAACAGAAAATAACGTAAGTGTGAGGATTTTTCAACTGACTTGCAGCAAC-A
• rs1555516191
• NM_004360.5:c.1553_1565+39delAACAGAAAATAACGTAAGTGTGAGGATTTTTCAACTGACTTGCAGCAACTGG

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_004360.5(CDH1):​c.1553_1565+39delAACAGAAAATAACGTAAGTGTGAGGATTTTTCAACTGACTTGCAGCAACTGG​(p.Glu518ArgfsTer23) variant causes a frameshift, splice donor, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. E518E) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay. The gene CDH1 is included in the ClinGen Criteria Specification Registry.

• Frequency: Genomes: not found (cov: 32)
• Consequence: CDH1 NM_004360.5 frameshift, splice_donor, splice_region, intron
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:4
• Conservation: PhyloP100: 8.95
• Publications: 1 publications found

Genes affected

CDH1 (HGNC:1748): (cadherin 1) This gene encodes a classical cadherin of the cadherin superfamily. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate the mature glycoprotein. This calcium-dependent cell-cell adhesion protein is comprised of five extracellular cadherin repeats, a transmembrane region and a highly conserved cytoplasmic tail. Mutations in this gene are correlated with gastric, breast, colorectal, thyroid and ovarian cancer. Loss of function of this gene is thought to contribute to cancer progression by increasing proliferation, invasion, and/or metastasis. The ectodomain of this protein mediates bacterial adhesion to mammalian cells and the cytoplasmic domain is required for internalization. This gene is present in a gene cluster with other members of the cadherin family on chromosome 16. [provided by RefSeq, Nov 2015]

CDH1 Gene-Disease associations (from GenCC):

• blepharocheilodontic syndrome 1

  Inheritance: AD Classification: DEFINITIVE, STRONG, MODERATE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), G2P, Illumina
• CDH1-related diffuse gastric and lobular breast cancer syndrome

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: ClinGen, Labcorp Genetics (formerly Invitae), G2P
• hereditary breast carcinoma

  Inheritance: AD Classification: DEFINITIVE Submitted by: Ambry Genetics
• hereditary diffuse gastric adenocarcinoma

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, Ambry Genetics
• cleft soft palate

  Inheritance: AD Classification: MODERATE Submitted by: Ambry Genetics
• orofacial cleft 3

  Inheritance: AD Classification: MODERATE Submitted by: Ambry Genetics
• blepharocheilodontic syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• familial ovarian cancer

  Inheritance: Unknown Classification: NO_KNOWN Submitted by: ClinGen

ENSG00000260798 (HGNC:):

ACMG classification

Specifications for CDH1 are available in the ClinGen Criteria Specification Registry and recommended for reference when assigning criteria.

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 16-68815743-ATGGAACAGAAAATAACGTAAGTGTGAGGATTTTTCAACTGACTTGCAGCAAC-A is Pathogenic according to our data. Variant chr16-68815743-ATGGAACAGAAAATAACGTAAGTGTGAGGATTTTTCAACTGACTTGCAGCAAC-A is described in ClinVar as Pathogenic/Likely_pathogenic. ClinVar VariationId is 486829.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_004360.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CDH1	NM_004360.5	MANE Select	c.1553_1565+39delAACAGAAAATAACGTAAGTGTGAGGATTTTTCAACTGACTTGCAGCAACTGG	p.Glu518ArgfsTer23	frameshift splice_donor splice_region intron	Exon 10 of 16	NP_004351.1	A0A0U2ZQU7
	CDH1	NM_001317186.2		c.-267_-255+39delAACAGAAAATAACGTAAGTGTGAGGATTTTTCAACTGACTTGCAGCAACTGG		splice_region	Exon 10 of 15	NP_001304115.1
	CDH1	NM_001317184.2		c.1370_1382+39delAACAGAAAATAACGTAAGTGTGAGGATTTTTCAACTGACTTGCAGCAACTGG	p.Glu457ArgfsTer23	frameshift splice_donor splice_region intron	Exon 9 of 15	NP_001304113.1	P12830-2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CDH1	ENST00000261769.10	TSL:1 MANE Select	c.1550_1565+36delTGGAACAGAAAATAACGTAAGTGTGAGGATTTTTCAACTGACTTGCAGCAAC	p.Met517ArgfsTer23	frameshift splice_donor splice_region intron	Exon 10 of 16	ENSP00000261769.4	P12830-1
	CDH1	ENST00000422392.6	TSL:1	c.1367_1382+36delTGGAACAGAAAATAACGTAAGTGTGAGGATTTTTCAACTGACTTGCAGCAAC	p.Met456ArgfsTer23	frameshift splice_donor splice_region intron	Exon 9 of 15	ENSP00000414946.2	P12830-2
	CDH1	ENST00000562836.5	TSL:1	n.1621_1636+36delTGGAACAGAAAATAACGTAAGTGTGAGGATTTTTCAACTGACTTGCAGCAAC		splice_donor splice_region intron non_coding_transcript_exon	Exon 9 of 15

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Pathogenic/Likely pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
2	-	-	Hereditary cancer-predisposing syndrome (2)
2	-	-	not provided (2)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		8.9

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555516191; hg19: chr16-68849646;