rs1555516191

Variant names:

• chr16-68815743-ATGGAACAGAAAATAACGTAAGTGTGAGGATTTTTCAACTGACTTGCAGCAAC-A
• rs1555516191
• NM_004360.5:c.1553_1565+39delAACAGAAAATAACGTAAGTGTGAGGATTTTTCAACTGACTTGCAGCAACTGG

Variant summary

Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1 PM2 PP5_Very_Strong

The NM_004360.5(CDH1):​c.1553_1565+39delAACAGAAAATAACGTAAGTGTGAGGATTTTTCAACTGACTTGCAGCAACTGG​(p.Glu518ArgfsTer23) variant causes a frameshift, splice donor, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: CDH1 NM_004360.5 frameshift, splice_donor, splice_region, intron
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:4
• Conservation: PhyloP100: 8.95

Genes affected

CDH1 (HGNC:1748): (cadherin 1) This gene encodes a classical cadherin of the cadherin superfamily. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate the mature glycoprotein. This calcium-dependent cell-cell adhesion protein is comprised of five extracellular cadherin repeats, a transmembrane region and a highly conserved cytoplasmic tail. Mutations in this gene are correlated with gastric, breast, colorectal, thyroid and ovarian cancer. Loss of function of this gene is thought to contribute to cancer progression by increasing proliferation, invasion, and/or metastasis. The ectodomain of this protein mediates bacterial adhesion to mammalian cells and the cytoplasmic domain is required for internalization. This gene is present in a gene cluster with other members of the cadherin family on chromosome 16. [provided by RefSeq, Nov 2015]

ENSG00000260798 (HGNC:):

ACMG classification

Verdict is Pathogenic. Variant got 18 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 16-68815743-ATGGAACAGAAAATAACGTAAGTGTGAGGATTTTTCAACTGACTTGCAGCAAC-A is Pathogenic according to our data. Variant chr16-68815743-ATGGAACAGAAAATAACGTAAGTGTGAGGATTTTTCAACTGACTTGCAGCAAC-A is described in ClinVar as [Likely_pathogenic]. Clinvar id is 486829.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
CDH1	NM_004360.5	c.1553_1565+39delAACAGAAAATAACGTAAGTGTGAGGATTTTTCAACTGACTTGCAGCAACTGG	p.Glu518ArgfsTer23	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 10 of 16	ENST00000261769.10	NP_004351.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
CDH1	ENST00000261769.10	c.1550_1565+36delTGGAACAGAAAATAACGTAAGTGTGAGGATTTTTCAACTGACTTGCAGCAAC	p.Met517ArgfsTer23	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 10 of 16	1	NM_004360.5	ENSP00000261769.4

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic/Likely pathogenic

Submissions summary: Pathogenic:4

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not provided Pathogenic:2

May 13, 2019

GeneDx

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Not observed in large population cohorts (Lek et al., 2016); Has not been previously published as pathogenic or benign to our knowledge -

Nov 08, 2017

Quest Diagnostics Nichols Institute San Juan Capistrano

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Hereditary cancer-predisposing syndrome Pathogenic:2

May 04, 2020

Color Diagnostics, LLC DBA Color Health

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant causes at a minimum the deletion of the last 13 nucleotides in exon 10 (r.1553_1565del) and the intron 10 splice donor site in the CDH1 gene. To our knowledge, functional and RNA studies have not been reported for this variant, nor has this variant been reported in individuals affected with hereditary cancer in the literature. Other variants that disrupted the canonical intron 10 splice donor site has been reported in individuals affected with breast and diffuse gastric cancer (PMID: 11968084, 18046629, 18788075, 24506336, 26182300, 26681312, 27064202, 27153395, and Lowstuter 2017 (https://ascopubs.org/doi/full/10.1200/PO.16.00021)). This variant has not been identified in the general population by the Genome Aggregation Database (gnomAD). Loss of CDH1 function is a known mechanism of disease. Based on the available evidence, this variant is classified as Likely Pathogenic. -

Mar 02, 2018

Ambry Genetics

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.1553_1565+39del52 variant spans the 3' exon/intron boundary of coding exon 10 in the CDH1 gene. This variant results from a deletion of 52 nucleotides at positions c.1553 to c.1565+39. Using the BDGP and ESEfinder splice site prediction tools, this alteration is predicted to abolish the native splice donor site; however, direct evidence is unavailable. Alterations that disrupt the canonical splice site are expected to cause aberrant splicing, resulting in an abnormal protein or a transcript that is subject to nonsense-mediated mRNA decay. As such, this alteration is classified as likely pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555516191; hg19: chr16-68849646;