rs1555516191
Variant summary
Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1PM2PP5_Very_Strong
The NM_004360.5(CDH1):c.1553_1565+39delAACAGAAAATAACGTAAGTGTGAGGATTTTTCAACTGACTTGCAGCAACTGG(p.Glu518fs) variant causes a frameshift, splice donor, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★★). Variant results in nonsense mediated mRNA decay.
Frequency
Genomes: not found (cov: 32)
Consequence
CDH1
NM_004360.5 frameshift, splice_donor, splice_region, intron
NM_004360.5 frameshift, splice_donor, splice_region, intron
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 8.95
Genes affected
CDH1 (HGNC:1748): (cadherin 1) This gene encodes a classical cadherin of the cadherin superfamily. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate the mature glycoprotein. This calcium-dependent cell-cell adhesion protein is comprised of five extracellular cadherin repeats, a transmembrane region and a highly conserved cytoplasmic tail. Mutations in this gene are correlated with gastric, breast, colorectal, thyroid and ovarian cancer. Loss of function of this gene is thought to contribute to cancer progression by increasing proliferation, invasion, and/or metastasis. The ectodomain of this protein mediates bacterial adhesion to mammalian cells and the cytoplasmic domain is required for internalization. This gene is present in a gene cluster with other members of the cadherin family on chromosome 16. [provided by RefSeq, Nov 2015]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Pathogenic. Variant got 18 ACMG points.
PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 16-68815743-ATGGAACAGAAAATAACGTAAGTGTGAGGATTTTTCAACTGACTTGCAGCAAC-A is Pathogenic according to our data. Variant chr16-68815743-ATGGAACAGAAAATAACGTAAGTGTGAGGATTTTTCAACTGACTTGCAGCAAC-A is described in ClinVar as [Likely_pathogenic]. Clinvar id is 486829.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
CDH1 | NM_004360.5 | c.1553_1565+39delAACAGAAAATAACGTAAGTGTGAGGATTTTTCAACTGACTTGCAGCAACTGG | p.Glu518fs | frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant | 10/16 | ENST00000261769.10 | NP_004351.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
CDH1 | ENST00000261769.10 | c.1553_1565+39delAACAGAAAATAACGTAAGTGTGAGGATTTTTCAACTGACTTGCAGCAACTGG | p.Glu518fs | frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant | 10/16 | 1 | NM_004360.5 | ENSP00000261769.4 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome Cov.: 32
GnomAD4 genome
Cov.:
32
ClinVar
Significance: Pathogenic/Likely pathogenic
Submissions summary: Pathogenic:4
Revision: criteria provided, multiple submitters, no conflicts
LINK: link
Submissions by phenotype
not provided Pathogenic:2
Pathogenic, criteria provided, single submitter | clinical testing | GeneDx | May 13, 2019 | Not observed in large population cohorts (Lek et al., 2016); Has not been previously published as pathogenic or benign to our knowledge - |
Likely pathogenic, criteria provided, single submitter | clinical testing | Quest Diagnostics Nichols Institute San Juan Capistrano | Nov 08, 2017 | - - |
Hereditary cancer-predisposing syndrome Pathogenic:2
Likely pathogenic, criteria provided, single submitter | clinical testing | Color Diagnostics, LLC DBA Color Health | May 04, 2020 | This variant causes at a minimum the deletion of the last 13 nucleotides in exon 10 (r.1553_1565del) and the intron 10 splice donor site in the CDH1 gene. To our knowledge, functional and RNA studies have not been reported for this variant, nor has this variant been reported in individuals affected with hereditary cancer in the literature. Other variants that disrupted the canonical intron 10 splice donor site has been reported in individuals affected with breast and diffuse gastric cancer (PMID: 11968084, 18046629, 18788075, 24506336, 26182300, 26681312, 27064202, 27153395, and Lowstuter 2017 (https://ascopubs.org/doi/full/10.1200/PO.16.00021)). This variant has not been identified in the general population by the Genome Aggregation Database (gnomAD). Loss of CDH1 function is a known mechanism of disease. Based on the available evidence, this variant is classified as Likely Pathogenic. - |
Likely pathogenic, criteria provided, single submitter | clinical testing | Ambry Genetics | Mar 02, 2018 | The c.1553_1565+39del52 variant spans the 3' exon/intron boundary of coding exon 10 in the CDH1 gene. This variant results from a deletion of 52 nucleotides at positions c.1553 to c.1565+39. Using the BDGP and ESEfinder splice site prediction tools, this alteration is predicted to abolish the native splice donor site; however, direct evidence is unavailable. Alterations that disrupt the canonical splice site are expected to cause aberrant splicing, resulting in an abnormal protein or a transcript that is subject to nonsense-mediated mRNA decay. As such, this alteration is classified as likely pathogenic. - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at