rs1555525957
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate
The NM_000546.6(TP53):c.522_559+5delGCGCTGCCCCCACCATGAGCGCTGCTCAGATAGCGATGGTGAG(p.Arg175fs) variant causes a frameshift, splice donor, splice region, intron change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_000546.6 frameshift, splice_donor, splice_region, intron
Scores
Clinical Significance
Conservation
Publications
- breast cancerInheritance: AD Classification: DEFINITIVE Submitted by: Ambry Genetics
- Li-Fraumeni syndromeInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), G2P, ClinGen, Orphanet
- Li-Fraumeni syndrome 1Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Genomics England PanelApp
- adrenocortical carcinoma, hereditaryInheritance: AD Classification: STRONG Submitted by: Ambry Genetics
- sarcomaInheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
- bone marrow failure syndrome 5Inheritance: AD Classification: MODERATE Submitted by: Ambry Genetics
- colorectal cancerInheritance: AD Classification: MODERATE Submitted by: Ambry Genetics
- choroid plexus carcinomaInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Transcripts
RefSeq
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
TP53 | ENST00000269305.9 | c.522_559+5delGCGCTGCCCCCACCATGAGCGCTGCTCAGATAGCGATGGTGAG | p.Arg175fs | frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant | Exon 5 of 11 | 1 | NM_000546.6 | ENSP00000269305.4 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 genome Cov.: 33
ClinVar
Submissions by phenotype
Li-Fraumeni syndrome Pathogenic:1
For these reasons, this variant has been classified as Pathogenic. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may disrupt the consensus splice site. ClinVar contains an entry for this variant (Variation ID: 528272). This variant has not been reported in the literature in individuals affected with TP53-related conditions. This variant is not present in population databases (gnomAD no frequency). This variant results in the deletion of part of exon 5 (c.522_559+5del43) of the TP53 gene. This deletion is out-of-frame, and is expected to create a premature termination codon and result in an absent or disrupted protein product. Loss-of-function variants in TP53 are known to be pathogenic (PMID: 20522432). -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at