Our verdict is Pathogenic. The variant received 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate
The NM_000546.6(TP53):c.522_559+5delGCGCTGCCCCCACCATGAGCGCTGCTCAGATAGCGATGGTGAG(p.Arg175fs) variant causes a frameshift, splice donor, splice region, intron change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.
TP53 (HGNC:11998): (tumor protein p53) This gene encodes a tumor suppressor protein containing transcriptional activation, DNA binding, and oligomerization domains. The encoded protein responds to diverse cellular stresses to regulate expression of target genes, thereby inducing cell cycle arrest, apoptosis, senescence, DNA repair, or changes in metabolism. Mutations in this gene are associated with a variety of human cancers, including hereditary cancers such as Li-Fraumeni syndrome. Alternative splicing of this gene and the use of alternate promoters result in multiple transcript variants and isoforms. Additional isoforms have also been shown to result from the use of alternate translation initiation codons from identical transcript variants (PMIDs: 12032546, 20937277). [provided by RefSeq, Dec 2016]
Our verdict: Pathogenic. The variant received 12 ACMG points.
PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 17-7675047-GCTCACCATCGCTATCTGAGCAGCGCTCATGGTGGGGGCAGCGC-G is Pathogenic according to our data. Variant chr17-7675047-GCTCACCATCGCTATCTGAGCAGCGCTCATGGTGGGGGCAGCGC-G is described in ClinVar as [Pathogenic]. Clinvar id is 528272.Status of the report is criteria_provided_single_submitter, 1 stars.
For these reasons, this variant has been classified as Pathogenic. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may disrupt the consensus splice site. ClinVar contains an entry for this variant (Variation ID: 528272). This variant has not been reported in the literature in individuals affected with TP53-related conditions. This variant is not present in population databases (gnomAD no frequency). This variant results in the deletion of part of exon 5 (c.522_559+5del43) of the TP53 gene. This deletion is out-of-frame, and is expected to create a premature termination codon and result in an absent or disrupted protein product. Loss-of-function variants in TP53 are known to be pathogenic (PMID: 20522432). -