rs1555525957
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate
The NM_000546.6(TP53):c.522_559+5delGCGCTGCCCCCACCATGAGCGCTGCTCAGATAGCGATGGTGAG(p.Arg175fs) variant causes a frameshift, splice donor, splice region, intron change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay. The gene TP53 is included in the ClinGen Criteria Specification Registry.
Frequency
Consequence
NM_000546.6 frameshift, splice_donor, splice_region, intron
Scores
Clinical Significance
Conservation
Publications
- breast cancerInheritance: AD Classification: DEFINITIVE Submitted by: Ambry Genetics
- Li-Fraumeni syndromeInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: G2P, Orphanet, Labcorp Genetics (formerly Invitae), ClinGen
- Li-Fraumeni syndrome 1Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Genomics England PanelApp, Ambry Genetics
- adrenocortical carcinoma, hereditaryInheritance: AD Classification: STRONG Submitted by: Ambry Genetics
- sarcomaInheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
- bone marrow failure syndrome 5Inheritance: AD Classification: MODERATE Submitted by: Ambry Genetics
- colorectal cancerInheritance: AD Classification: MODERATE Submitted by: Ambry Genetics
- choroid plexus carcinomaInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000546.6. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TP53 | MANE Select | c.522_559+5delGCGCTGCCCCCACCATGAGCGCTGCTCAGATAGCGATGGTGAG | p.Arg175fs | frameshift splice_donor splice_region intron | Exon 5 of 11 | NP_000537.3 | |||
| TP53 | c.522_559+5delGCGCTGCCCCCACCATGAGCGCTGCTCAGATAGCGATGGTGAG | p.Arg175fs | frameshift splice_donor splice_region intron | Exon 5 of 11 | NP_001119584.1 | K7PPA8 | |||
| TP53 | c.522_559+5delGCGCTGCCCCCACCATGAGCGCTGCTCAGATAGCGATGGTGAG | p.Arg175fs | frameshift splice_donor splice_region intron | Exon 6 of 12 | NP_001394191.1 | K7PPA8 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TP53 | TSL:1 MANE Select | c.522_559+5delGCGCTGCCCCCACCATGAGCGCTGCTCAGATAGCGATGGTGAG | p.Arg175fs | frameshift splice_donor splice_region intron | Exon 5 of 11 | ENSP00000269305.4 | P04637-1 | ||
| TP53 | TSL:1 | c.522_559+5delGCGCTGCCCCCACCATGAGCGCTGCTCAGATAGCGATGGTGAG | p.Arg175fs | frameshift splice_donor splice_region intron | Exon 5 of 11 | ENSP00000391478.2 | P04637-1 | ||
| TP53 | TSL:1 | c.405_442+5delGCGCTGCCCCCACCATGAGCGCTGCTCAGATAGCGATGGTGAG | p.Arg136fs | frameshift splice_donor splice_region intron | Exon 4 of 10 | ENSP00000478219.1 | P04637-4 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 genome Cov.: 33
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.