rs1555535403
Variant summary
Our verdict is Uncertain significance. The variant received 5 ACMG points: 5P and 0B. PM4PP3PP5_Moderate
The NM_001042492.3(NF1):c.7076_7102delTATTTATGGCAATCCGGAATCCTCTGG(p.Val2359_Leu2367del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. V2359V) has been classified as Likely benign.
Frequency
Consequence
NM_001042492.3 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- neurofibromatosis type 1Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: PanelApp Australia, Labcorp Genetics (formerly Invitae), Genomics England PanelApp, ClinGen, G2P
- neurofibromatosis-Noonan syndromeInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: PanelApp Australia, Genomics England PanelApp, Orphanet
- Moyamoya diseaseInheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
- hereditary pheochromocytoma-paragangliomaInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- familial ovarian cancerInheritance: Unknown Classification: NO_KNOWN Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 5 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001042492.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| NF1 | NM_001042492.3 | MANE Select | c.7076_7102delTATTTATGGCAATCCGGAATCCTCTGG | p.Val2359_Leu2367del | disruptive_inframe_deletion | Exon 48 of 58 | NP_001035957.1 | P21359-1 | |
| NF1 | NM_000267.4 | c.7013_7039delTATTTATGGCAATCCGGAATCCTCTGG | p.Val2338_Leu2346del | disruptive_inframe_deletion | Exon 47 of 57 | NP_000258.1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| NF1 | ENST00000358273.9 | TSL:1 MANE Select | c.7076_7102delTATTTATGGCAATCCGGAATCCTCTGG | p.Val2359_Leu2367del | disruptive_inframe_deletion | Exon 48 of 58 | ENSP00000351015.4 | P21359-1 | |
| NF1 | ENST00000356175.7 | TSL:1 | c.7013_7039delTATTTATGGCAATCCGGAATCCTCTGG | p.Val2338_Leu2346del | disruptive_inframe_deletion | Exon 47 of 57 | ENSP00000348498.3 | P21359-2 | |
| NF1 | ENST00000579081.6 | TSL:1 | n.*2241_*2267delTATTTATGGCAATCCGGAATCCTCTGG | non_coding_transcript_exon | Exon 48 of 58 | ENSP00000462408.2 | J3KSB5 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at