rs1555573717

Positions:

• chr17-50194323-GCCAGGCTGAAAGCCTGGGGCCTCACCTTGGCA-G

Variant summary

Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PVS1 PM2

The NM_000088.4(COL1A1):​c.1608_1614+25delTGCCAAGGTGAGGCCCCAGGCTTTCAGCCTGG​(p.Ala537fs) variant causes a frameshift, splice donor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as no classification for the single variant (no stars). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 31)
• Consequence: COL1A1 NM_000088.4 frameshift, splice_donor, splice_region, intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.454

Genes affected

COL1A1 (HGNC:2197): (collagen type I alpha 1 chain) This gene encodes the pro-alpha1 chains of type I collagen whose triple helix comprises two alpha1 chains and one alpha2 chain. Type I is a fibril-forming collagen found in most connective tissues and is abundant in bone, cornea, dermis and tendon. Mutations in this gene are associated with osteogenesis imperfecta types I-IV, Ehlers-Danlos syndrome type VIIA, Ehlers-Danlos syndrome Classical type, Caffey Disease and idiopathic osteoporosis. Reciprocal translocations between chromosomes 17 and 22, where this gene and the gene for platelet-derived growth factor beta are located, are associated with a particular type of skin tumor called dermatofibrosarcoma protuberans, resulting from unregulated expression of the growth factor. Two transcripts, resulting from the use of alternate polyadenylation signals, have been identified for this gene. [provided by R. Dalgleish, Feb 2008]

COL1A1 (HGNC:):

ACMG classification

Verdict is Pathogenic. Variant got 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
COL1A1	NM_000088.4	c.1608_1614+25delTGCCAAGGTGAGGCCCCAGGCTTTCAGCCTGG	p.Ala537fs	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	23/51	ENST00000225964.10	NP_000079.2
COL1A1	XM_011524341.2	c.1410_1416+25delTGCCAAGGTGAGGCCCCAGGCTTTCAGCCTGG	p.Ala471fs	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	20/48		XP_011522643.1
COL1A1	XM_005257058.5	c.1608_1614+25delTGCCAAGGTGAGGCCCCAGGCTTTCAGCCTGG	p.Ala537fs	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	23/49		XP_005257115.2
COL1A1	XM_005257059.5	c.958-1662_958-1631delTGCCAAGGTGAGGCCCCAGGCTTTCAGCCTGG		intron_variant			XP_005257116.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
COL1A1	ENST00000225964.10	c.1608_1614+25delTGCCAAGGTGAGGCCCCAGGCTTTCAGCCTGG	p.Ala537fs	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	23/51	1	NM_000088.4	ENSP00000225964.6
COL1A1	ENST00000463440.1	n.-3_4+25delTGCCAAGGTGAGGCCCCAGGCTTTCAGCCTGG		splice_donor_variant, splice_region_variant, intron_variant, non_coding_transcript_exon_variant	1/3	2
COL1A1	ENST00000471344.1	n.552_558+25delTGCCAAGGTGAGGCCCCAGGCTTTCAGCCTGG		splice_donor_variant, splice_region_variant, intron_variant, non_coding_transcript_exon_variant	7/8	2
COL1A1	ENST00000463440.1	n.-3_4+25delTGCCAAGGTGAGGCCCCAGGCTTTCAGCCTGG		upstream_gene_variant		2

Frequencies

GnomAD3 genomes Cov.: 31

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 31

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555573717; hg19: chr17-48271684;