rs1555574254

Variant names:

• chr17-40356061-TCTCATCCAGGAAATGTTGGAGAACTCAGAGGGCCTGGACACTCTGAGCGGACAGCCGGGGGGTGGGGGGCGGGACGGGGGTGGCCTGGCCCCCCCGCCAGGCAGCTGTAGCCCCAGCCTCAGCCCCAGCTCCAACAGAAGCAGCCCGGCCACCCACTCCCCGTGA-T
• rs1555574254
• NM_000964.4:c.1226_*1del

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_000964.4(RARA):​c.1226_*1del​(p.Leu409_Ter463delins???) variant causes a stop lost, conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as drug response (no stars).

• Frequency: Genomes: not found (cov: 31)
• Consequence: RARA NM_000964.4 stop_lost, conservative_inframe_deletion
• Clinical Significance: drug response no assertion criteria provided O:1
• Conservation: PhyloP100: 8.02
• Publications: 0 publications found

Genes affected

RARA (HGNC:9864): (retinoic acid receptor alpha) This gene represents a nuclear retinoic acid receptor. The encoded protein, retinoic acid receptor alpha, regulates transcription in a ligand-dependent manner. This gene has been implicated in regulation of development, differentiation, apoptosis, granulopoeisis, and transcription of clock genes. Translocations between this locus and several other loci have been associated with acute promyelocytic leukemia. Alternatively spliced transcript variants have been found for this locus.[provided by RefSeq, Sep 2010]

RARA Gene-Disease associations (from GenCC):

• multiple congenital anomalies/dysmorphic syndrome

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
• acute promyelocytic leukemia

  Inheritance: AD Classification: NO_KNOWN Submitted by: Ambry Genetics

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Stoplost variant in NM_000964.4 Downstream stopcodon found after 150 codons.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000964.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RARA	NM_000964.4	MANE Select	c.1226_*1del	p.Leu409_Ter463delins???	stop_lost conservative_inframe_deletion	Exon 9 of 9	NP_000955.1	P10276-1
	RARA	NM_000964.4	MANE Select	c.1226_*1del		3_prime_UTR	Exon 9 of 9	NP_000955.1	P10276-1
	RARA	NM_001145301.3		c.1226_*1del	p.Leu409_Ter463delins???	stop_lost conservative_inframe_deletion	Exon 9 of 9	NP_001138773.1	Q6I9R7

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RARA	ENST00000254066.10	TSL:1 MANE Select	c.1226_*1del	p.Leu409_Ter463delins???	stop_lost conservative_inframe_deletion	Exon 9 of 9	ENSP00000254066.5	P10276-1
	RARA	ENST00000394081.7	TSL:1	c.1211_*1del	p.Leu404_Ter458delins???	stop_lost conservative_inframe_deletion	Exon 8 of 8	ENSP00000377643.3	P10276-2
	RARA	ENST00000425707.7	TSL:1	c.935_*1del	p.Leu312_Ter366delins???	stop_lost conservative_inframe_deletion	Exon 7 of 7	ENSP00000389993.3	P10276-3

Frequencies

GnomAD3 genomes Cov.: 31

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 31

ClinVar

ClinVar submissions

Significance: drug response

Revision: no assertion criteria provided

Pathogenic	VUS	Benign	Condition
-	-	-	Tretinoin response (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		8.0

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555574254; hg19: chr17-38512313;