rs1555574254

chr17-40356061-TCTCATCCAGGAAATGTTGGAGAACTCAGAGGGCCTGGACACTCTGAGCGGACAGCCGGGGGGTGGGGGGCGGGACGGGGGTGGCCTGGCCCCCCCGCCAGGCAGCTGTAGCCCCAGCCTCAGCCCCAGCTCCAACAGAAGCAGCCCGGCCACCCACTCCCCGTGA-T

Variant summary

Our verdict is Uncertain significance. Variant got 3 ACMG points: 3P and 0B. PM4 PP3

The NM_000964.4(RARA):c.1226_*1del variant causes a stop lost, inframe deletion change involving the alteration of a conserved nucleotide. Variant has been reported in ClinVar as drug response (no stars).

• Frequency: Genomes: not found (cov: 31)
• Consequence: RARA NM_000964.4 stop_lost, inframe_deletion
• Clinical Significance: drug response no assertion criteria provided O:1
• Conservation: PhyloP100: 8.02

Genes affected

RARA (HGNC:9864): (retinoic acid receptor alpha) This gene represents a nuclear retinoic acid receptor. The encoded protein, retinoic acid receptor alpha, regulates transcription in a ligand-dependent manner. This gene has been implicated in regulation of development, differentiation, apoptosis, granulopoeisis, and transcription of clock genes. Translocations between this locus and several other loci have been associated with acute promyelocytic leukemia. Alternatively spliced transcript variants have been found for this locus.[provided by RefSeq, Sep 2010]

ACMG classification

Verdict is Uncertain_significance. Variant got 3 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_000964.4.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	UniProt
RARA	NM_000964.4	c.1226_*1del		stop_lost, inframe_deletion	9/9	ENST00000254066.10

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Appris	UniProt
RARA	ENST00000254066.10	c.1226_*1del		stop_lost, inframe_deletion	9/9	1	NM_000964.4	P4

Frequencies

GnomAD3 genomes Cov.: 31

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 31

ClinVar

Significance: drug response

Submissions summary: Other:1

Revision: no assertion criteria provided

Submissions by phenotype

Tretinoin response Other:1

drug response, no assertion criteria provided

clinical testing

Center for Advanced Molecular Diagnostics, Cytogenetics Laboratory, Brigham and Women's Hospital

Mar 01, 2015

Associated with resistance of acute promyelocytic leukemia to all trans retinoic acid (ATRA) Failure of ATRA therapy

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555574254; hg19: chr17-38512313;