rs1555574254

Variant names:

• chr17-40356061-TCTCATCCAGGAAATGTTGGAGAACTCAGAGGGCCTGGACACTCTGAGCGGACAGCCGGGGGGTGGGGGGCGGGACGGGGGTGGCCTGGCCCCCCCGCCAGGCAGCTGTAGCCCCAGCCTCAGCCCCAGCTCCAACAGAAGCAGCCCGGCCACCCACTCCCCGTGA-T
• rs1555574254
• NM_000964.4:c.1226_*1del

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_000964.4(RARA):​c.1226_*1del​(p.Leu409_Ter463delins???) variant causes a stop lost, conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as drug response (no stars).

• Frequency: Genomes: not found (cov: 31)
• Consequence: RARA NM_000964.4 stop_lost, conservative_inframe_deletion
• Clinical Significance: drug response no assertion criteria provided O:1
• Conservation: PhyloP100: 8.02
• Publications: 0 publications found

Genes affected

RARA (HGNC:9864): (retinoic acid receptor alpha) This gene represents a nuclear retinoic acid receptor. The encoded protein, retinoic acid receptor alpha, regulates transcription in a ligand-dependent manner. This gene has been implicated in regulation of development, differentiation, apoptosis, granulopoeisis, and transcription of clock genes. Translocations between this locus and several other loci have been associated with acute promyelocytic leukemia. Alternatively spliced transcript variants have been found for this locus.[provided by RefSeq, Sep 2010]

RARA Gene-Disease associations (from GenCC):

• multiple congenital anomalies/dysmorphic syndrome

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
• acute promyelocytic leukemia

  Inheritance: AD Classification: NO_KNOWN Submitted by: Ambry Genetics

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Stoplost variant in NM_000964.4 Downstream stopcodon found after 150 codons.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
RARA	NM_000964.4	c.1226_*1del	p.Leu409_Ter463delins???	stop_lost, conservative_inframe_deletion	Exon 9 of 9	ENST00000254066.10	NP_000955.1
RARA	NM_000964.4	c.1226_*1del		3_prime_UTR_variant	Exon 9 of 9	ENST00000254066.10	NP_000955.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
RARA	ENST00000254066.10	c.1226_*1del	p.Leu409_Ter463delins???	stop_lost, conservative_inframe_deletion	Exon 9 of 9	1	NM_000964.4	ENSP00000254066.5
RARA	ENST00000254066.10	c.1226_*1del		3_prime_UTR_variant	Exon 9 of 9	1	NM_000964.4	ENSP00000254066.5

Frequencies

GnomAD3 genomes Cov.: 31

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 31

ClinVar

Significance: drug response

Submissions summary: Other:1

Revision: no assertion criteria provided

Submissions by phenotype

Tretinoin response Other:1

Mar 01, 2015

Center for Advanced Molecular Diagnostics, Cytogenetics Laboratory, Brigham and Women's Hospital

Significance: drug response

Review Status: no assertion criteria provided

Collection Method: clinical testing

Associated with resistance of acute promyelocytic leukemia to all trans retinoic acid (ATRA) Failure of ATRA therapy

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		8.0

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555574254; hg19: chr17-38512313;