rs1555593640
Variant summary
Our verdict is Likely benign. The variant received -2 ACMG points: 0P and 2B. BP6_Moderate
The NM_007294.4(BRCA1):c.594-56_594-19delAGTTCTGCATACATGTAACTAGTGTTTCTTATTAGGAC variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★). The gene BRCA1 is included in the ClinGen Criteria Specification Registry.
Frequency
Consequence
NM_007294.4 intron
Scores
Clinical Significance
Conservation
Publications
- BRCA1-related cancer predispositionInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- breast-ovarian cancer, familial, susceptibility to, 1Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Ambry Genetics
- Fanconi anemia, complementation group SInheritance: AR Classification: DEFINITIVE, STRONG, MODERATE, LIMITED Submitted by: G2P, Labcorp Genetics (formerly Invitae), Ambry Genetics, ClinGen
- pancreatic cancer, susceptibility to, 4Inheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
- hereditary breast ovarian cancer syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Fanconi anemiaInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -2 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_007294.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| BRCA1 | MANE Select | c.594-56_594-19delAGTTCTGCATACATGTAACTAGTGTTTCTTATTAGGAC | intron | N/A | NP_009225.1 | P38398-1 | |||
| BRCA1 | c.594-56_594-19delAGTTCTGCATACATGTAACTAGTGTTTCTTATTAGGAC | intron | N/A | NP_001394510.1 | A0A2R8Y7V5 | ||||
| BRCA1 | c.594-56_594-19delAGTTCTGCATACATGTAACTAGTGTTTCTTATTAGGAC | intron | N/A | NP_001394511.1 | A0A2R8Y7V5 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| BRCA1 | TSL:1 MANE Select | c.594-56_594-19delAGTTCTGCATACATGTAACTAGTGTTTCTTATTAGGAC | intron | N/A | ENSP00000350283.3 | P38398-1 | |||
| BRCA1 | TSL:1 | c.594-56_594-19delAGTTCTGCATACATGTAACTAGTGTTTCTTATTAGGAC | intron | N/A | ENSP00000418960.2 | P38398-7 | |||
| BRCA1 | TSL:1 | c.594-56_594-19delAGTTCTGCATACATGTAACTAGTGTTTCTTATTAGGAC | intron | N/A | ENSP00000419274.2 | P38398-1 |
Frequencies
GnomAD3 genomes Cov.: 31
GnomAD4 genome Cov.: 31
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.