rs1555599208

Positions:

• chr17-43115725-CTTGCAAAATATGTGGTCACACTTTGTGGAGACAGGTTCCTTGATCAACTCCAGA-C

Variant summary

Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PM2 PP5_Very_Strong

The NM_007294.4(BRCA1):​c.81_134delTCTGGAGTTGATCAAGGAACCTGTCTCCACAAAGTGTGACCACATATTTTGCAA variant causes a exon loss, splice region change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★★★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: BRCA1 NM_007294.4 exon_loss, splice_region
• Clinical Significance: Pathogenic reviewed by expert panel P:2
• Conservation: PhyloP100: 4.40

Genes affected

BRCA1 (HGNC:1100): (BRCA1 DNA repair associated) This gene encodes a 190 kD nuclear phosphoprotein that plays a role in maintaining genomic stability, and it also acts as a tumor suppressor. The BRCA1 gene contains 22 exons spanning about 110 kb of DNA. The encoded protein combines with other tumor suppressors, DNA damage sensors, and signal transducers to form a large multi-subunit protein complex known as the BRCA1-associated genome surveillance complex (BASC). This gene product associates with RNA polymerase II, and through the C-terminal domain, also interacts with histone deacetylase complexes. This protein thus plays a role in transcription, DNA repair of double-stranded breaks, and recombination. Mutations in this gene are responsible for approximately 40% of inherited breast cancers and more than 80% of inherited breast and ovarian cancers. Alternative splicing plays a role in modulating the subcellular localization and physiological function of this gene. Many alternatively spliced transcript variants, some of which are disease-associated mutations, have been described for this gene, but the full-length natures of only some of these variants has been described. A related pseudogene, which is also located on chromosome 17, has been identified. [provided by RefSeq, May 2020]

BRCA1 (HGNC:):

ACMG classification

Verdict is Pathogenic. Variant got 10 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 17-43115725-CTTGCAAAATATGTGGTCACACTTTGTGGAGACAGGTTCCTTGATCAACTCCAGA-C is Pathogenic according to our data. Variant chr17-43115725-CTTGCAAAATATGTGGTCACACTTTGTGGAGACAGGTTCCTTGATCAACTCCAGA-C is described in ClinVar as [Pathogenic]. Clinvar id is 224416.Status of the report is reviewed_by_expert_panel, 3 stars. Variant chr17-43115725-CTTGCAAAATATGTGGTCACACTTTGTGGAGACAGGTTCCTTGATCAACTCCAGA-C is described in Lovd as [Pathogenic].

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
BRCA1	NM_007294.4	c.81_134delTCTGGAGTTGATCAAGGAACCTGTCTCCACAAAGTGTGACCACATATTTTGCAA		exon_loss_variant, splice_region_variant	3/23	ENST00000357654.9	NP_009225.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
BRCA1	ENST00000357654.9	c.81_134delTCTGGAGTTGATCAAGGAACCTGTCTCCACAAAGTGTGACCACATATTTTGCAA		exon_loss_variant, splice_region_variant	3/23	1	NM_007294.4	ENSP00000350283.3

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:2

Revision: reviewed by expert panel

Submissions by phenotype

Breast-ovarian cancer, familial, susceptibility to, 1 Pathogenic:1

Pathogenic, reviewed by expert panel

curation

Evidence-based Network for the Interpretation of Germline Mutant Alleles (ENIGMA)

Dec 15, 2017

Variant allele predicted to encode a truncated non-functional protein. -

Breast neoplasm Pathogenic:1

Pathogenic, criteria provided, single submitter

research

Laboratory of Molecular Diagnosis of Cancer, West China Hospital, Sichuan University

Nov 01, 2015

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555599208; hg19: chr17-41267742;