rs1555760738

Variant names:

• chr19-12943750-AGCAGAGGCTTAAGGAGGAGGAAGAAGACAAGAAACGCAAAGAGGAGGAGGAG-A
• rs1555760738
• NM_004343.4:c.1099_1150delCTTAAGGAGGAGGAAGAAGACAAGAAACGCAAAGAGGAGGAGGAGGCAGAGG

Variant summary

Our verdict is Pathogenic. The variant received 12 ACMG points: 12P and 0B. PVS1_Strong PP5_Very_Strong

The NM_004343.4(CALR):​c.1099_1150delCTTAAGGAGGAGGAAGAAGACAAGAAACGCAAAGAGGAGGAGGAGGCAGAGG​(p.Leu367ThrfsTer46) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.0000301 in 1,460,220 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. There is a variant allele frequency bias in the population database for this variant (GnomAdExome4), which may indicate mosaicism or somatic mutations in the reference population data. Variant has been reported in ClinVar as Likely pathogenic (★★).

• Frequency:
  • Genomes: 𝑓 0.000020 (0 hom., cov: 31)
  • Exomes 𝑓: 0.000030 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: CALR NM_004343.4 frameshift
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:4 O:4
• Conservation: PhyloP100: 8.15
• Publications: 3 publications found

Genes affected

CALR (HGNC:1455): (calreticulin) Calreticulin is a highly conserved chaperone protein which resides primarily in the endoplasmic reticulum, and is involved in a variety of cellular processes, among them, cell adhesion. Additionally, it functions in protein folding quality control and calcium homeostasis. Calreticulin is also found in the nucleus, suggesting that it may have a role in transcription regulation. Systemic lupus erythematosus is associated with increased autoantibody titers against calreticulin. Recurrent mutations in calreticulin have been linked to various neoplasms, including the myeloproliferative type.[provided by RefSeq, May 2020]

ACMG classification

Our verdict: Pathogenic. The variant received 12 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.124 CDS is truncated, and there are 2 pathogenic variants in the truncated region.
• PP5: Variant 19-12943750-AGCAGAGGCTTAAGGAGGAGGAAGAAGACAAGAAACGCAAAGAGGAGGAGGAG-A is Pathogenic according to our data. Variant chr19-12943750-AGCAGAGGCTTAAGGAGGAGGAAGAAGACAAGAAACGCAAAGAGGAGGAGGAG-A is described in ClinVar as Pathogenic/Likely_pathogenic. ClinVar VariationId is 97006.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_004343.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CALR	NM_004343.4	MANE Select	c.1099_1150delCTTAAGGAGGAGGAAGAAGACAAGAAACGCAAAGAGGAGGAGGAGGCAGAGG	p.Leu367ThrfsTer46	frameshift	Exon 9 of 9	NP_004334.1	P27797

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CALR	ENST00000316448.10	TSL:1 MANE Select	c.1099_1150delCTTAAGGAGGAGGAAGAAGACAAGAAACGCAAAGAGGAGGAGGAGGCAGAGG	p.Leu367ThrfsTer46	frameshift	Exon 9 of 9	ENSP00000320866.4	P27797
	CALR	ENST00000957023.1		c.1093_1144delCTTAAGGAGGAGGAAGAAGACAAGAAACGCAAAGAGGAGGAGGAGGCAGAGG	p.Leu365ThrfsTer46	frameshift	Exon 9 of 9	ENSP00000627082.1
	CALR	ENST00000929790.1		c.1087_1138delCTTAAGGAGGAGGAAGAAGACAAGAAACGCAAAGAGGAGGAGGAGGCAGAGG	p.Leu363ThrfsTer46	frameshift	Exon 9 of 9	ENSP00000599849.1

Frequencies

GnomAD3 genomes AF: 0.0000197 AC: 3 AN: 152176 Hom.: 0 Cov.: 31

Gnomad AFR AF: 0.0000241

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0000655

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000147

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.00000812 AC: 2 AN: 246350 AF XY: 0.00000750

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.0000294

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00000904

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.0000301 AC: 44 AN: 1460220 Hom.: 0 AF XY: 0.0000441 AC XY: 32 AN XY: 726272

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.0000299 AC: 1 AN: 33440

American (AMR) AF: 0.0000226 AC: 1 AN: 44302

Ashkenazi Jewish (ASJ) AF: 0.0000383 AC: 1 AN: 26092

East Asian (EAS) AF: 0.0000252 AC: 1 AN: 39666

South Asian (SAS) AF: 0.00 AC: 0 AN: 86106

European-Finnish (FIN) AF: 0.0000187 AC: 1 AN: 53350

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5766

European-Non Finnish (NFE) AF: 0.0000342 AC: 38 AN: 1111170

Other (OTH) AF: 0.0000166 AC: 1 AN: 60328

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000197 AC: 3 AN: 152176 Hom.: 0 Cov.: 31 AF XY: 0.0000269 AC XY: 2 AN XY: 74348

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.0000241 AC: 1 AN: 41450

American (AMR) AF: 0.0000655 AC: 1 AN: 15268

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3472

East Asian (EAS) AF: 0.00 AC: 0 AN: 5196

South Asian (SAS) AF: 0.00 AC: 0 AN: 4834

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10614

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.0000147 AC: 1 AN: 68022

Other (OTH) AF: 0.00 AC: 0 AN: 2092

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5. (p-value = 0.0000000000000565104), which strongly suggests a high chance of mosaicism in these individuals.

Alfa AF: 0.00 Hom.: 0

ClinVar

ClinVar submissions

Significance: Pathogenic/Likely pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
1	-	-	not provided (1)
1	-	-	Primary myelofibrosis (1)
1	-	-	Primary myelofibrosis;C3277671:Thrombocythemia 1 (1)
1	-	-	Thrombocythemia 1 (1)
-	-	-	Acute myeloid leukemia (2)
-	-	-	Essential thrombocythemia (2)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		8.2
Mutation Taster		=22/178	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555760738; hg19: chr19-13054564; COSMIC: COSV57116546; COSMIC: COSV57116546;