rs1555760738

Positions:

• chr19-12943750-AGCAGAGGCTTAAGGAGGAGGAAGAAGACAAGAAACGCAAAGAGGAGGAGGAG-A

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 6P and 4B. PVS1_Strong PP5_Moderate BS2

The NM_004343.4(CALR):​c.1099_1150delCTTAAGGAGGAGGAAGAAGACAAGAAACGCAAAGAGGAGGAGGAGGCAGAGG​(p.Leu367fs) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.0000301 in 1,460,220 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency:
  • Genomes: 𝑓 0.000020 (0 hom., cov: 31)
  • Exomes 𝑓: 0.000030 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: CALR NM_004343.4 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:3 O:4
• Conservation: PhyloP100: 8.15

Genes affected

CALR (HGNC:1455): (calreticulin) Calreticulin is a highly conserved chaperone protein which resides primarily in the endoplasmic reticulum, and is involved in a variety of cellular processes, among them, cell adhesion. Additionally, it functions in protein folding quality control and calcium homeostasis. Calreticulin is also found in the nucleus, suggesting that it may have a role in transcription regulation. Systemic lupus erythematosus is associated with increased autoantibody titers against calreticulin. Recurrent mutations in calreticulin have been linked to various neoplasms, including the myeloproliferative type.[provided by RefSeq, May 2020]

CALR (HGNC:):

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.124 CDS is truncated, and there are 0 pathogenic variants in the truncated region.
• PP5: Variant 19-12943750-AGCAGAGGCTTAAGGAGGAGGAAGAAGACAAGAAACGCAAAGAGGAGGAGGAG-A is Pathogenic according to our data. Variant chr19-12943750-AGCAGAGGCTTAAGGAGGAGGAAGAAGACAAGAAACGCAAAGAGGAGGAGGAG-A is described in ClinVar as [Pathogenic]. Clinvar id is 97006.Status of the report is criteria_provided_single_submitter, 1 stars.
• BS2: High AC in GnomAdExome4 at 44 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
CALR	NM_004343.4	c.1099_1150delCTTAAGGAGGAGGAAGAAGACAAGAAACGCAAAGAGGAGGAGGAGGCAGAGG	p.Leu367fs	frameshift_variant	9/9	ENST00000316448.10	NP_004334.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
CALR	ENST00000316448.10	c.1099_1150delCTTAAGGAGGAGGAAGAAGACAAGAAACGCAAAGAGGAGGAGGAGGCAGAGG	p.Leu367fs	frameshift_variant	9/9	1	NM_004343.4	ENSP00000320866.4

Frequencies

GnomAD3 genomes AF: 0.00 AC: 3 AN: 152176 Hom.: 0 Cov.: 31 FAILED QC

Gnomad AFR AF: 0.0000241

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0000655

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000147

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.0000301 AC: 44 AN: 1460220 Hom.: 0 AF XY: 0.0000441 AC XY: 32 AN XY: 726272

Gnomad4 AFR exome AF: 0.0000299

Gnomad4 AMR exome AF: 0.0000226

Gnomad4 ASJ exome AF: 0.0000383

Gnomad4 EAS exome AF: 0.0000252

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.0000187

Gnomad4 NFE exome AF: 0.0000342

Gnomad4 OTH exome AF: 0.0000166

GnomAD4 genome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000197 AC: 3 AN: 152176 Hom.: 0 Cov.: 31 AF XY: 0.0000269 AC XY: 2 AN XY: 74348

Gnomad4 AFR AF: 0.0000241

Gnomad4 AMR AF: 0.0000655

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000147

Gnomad4 OTH AF: 0.00

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:3 Other:4

Revision: criteria provided, single submitter

Submissions by phenotype

Essential thrombocythemia Other:2

-, no assertion criteria provided	clinical testing	Molecular Diagnostics Laboratory, Fox Chase Cancer Center - Temple Health	Jan 24, 2024	A large majority of myeloproliferative neoplasms with nonmutated JAK2 exhibit somatic CALR mutations. In a subset of such cases with essential thrombocythemia, 67% had CALR mutation. -
-, no assertion criteria provided	clinical testing	Molecular Diagnostics Laboratory, Fox Chase Cancer Center - Temple Health	Jan 24, 2024	In a cohort of 1107 myeloproliferative neoplasm patients, those with "mutated CALR had a lower risk of thromobsis and longer overall survival than patients with mutated JAK2." -

Acute myeloid leukemia Other:2

-, no assertion criteria provided	clinical testing	Molecular Diagnostics Laboratory, Fox Chase Cancer Center - Temple Health	Jan 24, 2024	While there are strong associations of this variant to thrombocythemia and myeloproliferative neoplasms, its oncogenicity and clinical impact in this case of acute myeloid leukemia is uncertain because the allele frequency decreased over time from 11% (progressive thrombocythemia) to 3% (AML in remission) to undetectable at AML relapse. -
-, no assertion criteria provided	clinical testing	Molecular Diagnostics Laboratory, Fox Chase Cancer Center - Temple Health	Jan 24, 2024	While there are strong associations of this variant to thrombocythemia and myeloproliferative neoplasms, its oncogenicity and clinical impact in this case of acute myeloid leukemia is uncertain because the allele frequency decreased over time from 11% (progressive thrombocythemia) to 3% (AML in remission) to undetectable at AML relapse. -

Thrombocythemia 1 Pathogenic:1

Pathogenic, no assertion criteria provided

literature only

OMIM

Dec 19, 2013

- -

Primary myelofibrosis Pathogenic:1

Pathogenic, no assertion criteria provided

literature only

OMIM

Dec 19, 2013

- -

Primary myelofibrosis;C3277671:Thrombocythemia 1 Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

Fulgent Genetics, Fulgent Genetics

Feb 10, 2022

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555760738; hg19: chr19-13054564;