rs1555797492

Variant names:

• chr19-11061814-T-TGAGCCCCGACATTCCAGTCTCGACCCC
• rs1555797492
• ENST00000592604.6:n.3191_3217dupGACATTCCAGTCTCGACCCCGAGCCCC

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The ENST00000592604.6(SMARCA4):​n.3191_3217dupGACATTCCAGTCTCGACCCCGAGCCCC variant causes a non coding transcript exon change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: SMARCA4 ENST00000592604.6 non_coding_transcript_exon
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 2.16
• Publications: 0 publications found

Genes affected

SMARCA4 (HGNC:11100): (SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4) The protein encoded by this gene is a member of the SWI/SNF family of proteins and is similar to the brahma protein of Drosophila. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. In addition, this protein can bind BRCA1, as well as regulate the expression of the tumorigenic protein CD44. Mutations in this gene cause rhabdoid tumor predisposition syndrome type 2. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]

SMARCA4 Gene-Disease associations (from GenCC):

• Coffin-Siris syndrome

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet, Illumina
• intellectual disability, autosomal dominant 16

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae), Ambry Genetics
• rhabdoid tumor predisposition syndrome 2

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, ClinGen, Genomics England PanelApp, Labcorp Genetics (formerly Invitae), G2P
• uterine corpus sarcoma

  Inheritance: AR Classification: MODERATE Submitted by: Genomics England PanelApp
• familial rhabdoid tumor

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• hereditary nonpolyposis colon cancer

  Inheritance: AD Classification: LIMITED Submitted by: ClinGen

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Variant Effect in Transcripts

ACMG analysis was done for transcript: ENST00000592604.6. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SMARCA4	NM_001387283.1	MANE Plus Clinical	c.*6_*32dupGACATTCCAGTCTCGACCCCGAGCCCC		3_prime_UTR	Exon 36 of 36	NP_001374212.1
	SMARCA4	NM_003072.5	MANE Select	c.*6_*32dupGACATTCCAGTCTCGACCCCGAGCCCC		3_prime_UTR	Exon 35 of 35	NP_003063.2
	SMARCA4	NR_164683.1		n.5337_5363dupGACATTCCAGTCTCGACCCCGAGCCCC		non_coding_transcript_exon	Exon 36 of 36

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SMARCA4	ENST00000592604.6	TSL:1	n.3191_3217dupGACATTCCAGTCTCGACCCCGAGCCCC		non_coding_transcript_exon	Exon 19 of 19
	SMARCA4	ENST00000646693.2	MANE Plus Clinical	c.*6_*32dupGACATTCCAGTCTCGACCCCGAGCCCC		3_prime_UTR	Exon 36 of 36	ENSP00000495368.1
	SMARCA4	ENST00000344626.10	TSL:1 MANE Select	c.*6_*32dupGACATTCCAGTCTCGACCCCGAGCCCC		3_prime_UTR	Exon 35 of 35	ENSP00000343896.4

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 30

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions as Germline

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	Rhabdoid tumor predisposition syndrome 2 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.2

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555797492; hg19: chr19-11172490;