rs1555805127

Positions:

• chr19-11113262-C-CTCCCCGGACCCCCAGGCTCCATCGCCTACCTCTTCTTCACCAACCGGCACGAGGTCAGGAAGATGACGCTGGACCGGAGCGAGTACACCAGCCTCA

Variant summary

Our verdict is Likely pathogenic. Variant got 8 ACMG points: 8P and 0B. PM1 PM2 PM4 PP5_Moderate

The NM_000527.5(LDLR):​c.1187-10_1272dupGGACCCCCAGGCTCCATCGCCTACCTCTTCTTCACCAACCGGCACGAGGTCAGGAAGATGACGCTGGACCGGAGCGAGTACACCAGCCTCATCCCC​(p.Pro424_Asn425insGlyProProGlySerIleAlaTyrLeuPhePheThrAsnArgHisGluValArgLysMetThrLeuAspArgSerGluTyrThrSerLeuIlePro) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★).

• Frequency: Genomes: not found (cov: 29)
• Consequence: LDLR NM_000527.5 conservative_inframe_insertion
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 0.631

Genes affected

LDLR (HGNC:6547): (low density lipoprotein receptor) The low density lipoprotein receptor (LDLR) gene family consists of cell surface proteins involved in receptor-mediated endocytosis of specific ligands. The encoded protein is normally bound at the cell membrane, where it binds low density lipoprotein/cholesterol and is taken into the cell. Lysosomes release the cholesterol, which is made available for repression of microsomal enzyme 3-hydroxy-3-methylglutaryl coenzyme A (HMG CoA) reductase, the rate-limiting step in cholesterol synthesis. At the same time, a reciprocal stimulation of cholesterol ester synthesis takes place. Mutations in this gene cause the autosomal dominant disorder, familial hypercholesterolemia. Alternate splicing results in multiple transcript variants.[provided by RefSeq, May 2022]

LDLR (HGNC:):

ACMG classification

Verdict is Likely_pathogenic. Variant got 8 ACMG points.

• PM1: In a repeat LDL-receptor class B 1 (size 41) in uniprot entity LDLR_HUMAN there are 61 pathogenic changes around while only 8 benign (88%) in NM_000527.5
• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_000527.5.
• PP5: Variant 19-11113262-C-CTCCCCGGACCCCCAGGCTCCATCGCCTACCTCTTCTTCACCAACCGGCACGAGGTCAGGAAGATGACGCTGGACCGGAGCGAGTACACCAGCCTCA is Pathogenic according to our data. Variant chr19-11113262-C-CTCCCCGGACCCCCAGGCTCCATCGCCTACCTCTTCTTCACCAACCGGCACGAGGTCAGGAAGATGACGCTGGACCGGAGCGAGTACACCAGCCTCA is described in ClinVar as [Likely_pathogenic]. Clinvar id is 403639.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
LDLR	NM_000527.5	c.1187-10_1272dupGGACCCCCAGGCTCCATCGCCTACCTCTTCTTCACCAACCGGCACGAGGTCAGGAAGATGACGCTGGACCGGAGCGAGTACACCAGCCTCATCCCC	p.Pro424_Asn425insGlyProProGlySerIleAlaTyrLeuPhePheThrAsnArgHisGluValArgLysMetThrLeuAspArgSerGluTyrThrSerLeuIlePro	conservative_inframe_insertion	9/18	ENST00000558518.6	NP_000518.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
LDLR	ENST00000558518.6	c.1187-10_1272dupGGACCCCCAGGCTCCATCGCCTACCTCTTCTTCACCAACCGGCACGAGGTCAGGAAGATGACGCTGGACCGGAGCGAGTACACCAGCCTCATCCCC	p.Pro424_Asn425insGlyProProGlySerIleAlaTyrLeuPhePheThrAsnArgHisGluValArgLysMetThrLeuAspArgSerGluTyrThrSerLeuIlePro	conservative_inframe_insertion	9/18	1	NM_000527.5	ENSP00000454071.1

Frequencies

GnomAD3 genomes Cov.: 29

GnomAD4 exome Cov.: 32

GnomAD4 genome Cov.: 29

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Hypercholesterolemia, familial, 1 Pathogenic:1

Likely pathogenic, criteria provided, single submitter

clinical testing

Molecular Genetics Laboratory, Centre for Cardiovascular Surgery and Transplantation

Nov 05, 2016

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555805127; hg19: chr19-11223938;