rs1555815437

Variant names:

• chr19-40512839-A-ACAGCGGGCGGCGCGCATGAC
• rs1555815437
• NM_020971.3:c.2052_2071dupAGCGGGCGGCGCGCATGACC

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_020971.3(SPTBN4):​c.2052_2071dupAGCGGGCGGCGCGCATGACC​(p.Leu691GlnfsTer59) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 33)
• Consequence: SPTBN4 NM_020971.3 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 2.44
• Publications: 0 publications found

Genes affected

SPTBN4 (HGNC:14896): (spectrin beta, non-erythrocytic 4) Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is composed of two antiparallel dimers of alpha- and beta- subunits. This gene is one member of a family of beta-spectrin genes. The encoded protein localizes to the nuclear matrix, PML nuclear bodies, and cytoplasmic vesicles. A highly similar gene in the mouse is required for localization of specific membrane proteins in polarized regions of neurons. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

SPTBN4 Gene-Disease associations (from GenCC):

• neurodevelopmental disorder with hypotonia, neuropathy, and deafness

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: G2P, ClinGen, Labcorp Genetics (formerly Invitae), Illumina, PanelApp Australia

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 19-40512839-A-ACAGCGGGCGGCGCGCATGAC is Pathogenic according to our data. Variant chr19-40512839-A-ACAGCGGGCGGCGCGCATGAC is described in ClinVar as Pathogenic. ClinVar VariationId is 521395.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_020971.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SPTBN4	NM_020971.3	MANE Select	c.2052_2071dupAGCGGGCGGCGCGCATGACC	p.Leu691GlnfsTer59	frameshift	Exon 14 of 36	NP_066022.2

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SPTBN4	ENST00000598249.6	TSL:1 MANE Select	c.2052_2071dupAGCGGGCGGCGCGCATGACC	p.Leu691GlnfsTer59	frameshift	Exon 14 of 36	ENSP00000469242.1
	SPTBN4	ENST00000352632.7	TSL:5	c.2052_2071dupAGCGGGCGGCGCGCATGACC	p.Leu691GlnfsTer59	frameshift	Exon 14 of 36	ENSP00000263373.2
	SPTBN4	ENST00000595535.5	TSL:5	c.2052_2071dupAGCGGGCGGCGCGCATGACC	p.Leu691GlnfsTer59	frameshift	Exon 14 of 27	ENSP00000470693.1

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome Cov.: 31

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Inborn genetic diseases Pathogenic:1

May 10, 2018

Ambry Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.4
Mutation Taster		=1/199	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555815437; hg19: chr19-41018746;