chr19-40512839-A-ACAGCGGGCGGCGCGCATGAC

Position:

• chr19-40512839-A-ACAGCGGGCGGCGCGCATGAC

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1 PM2 PP5_Moderate

The NM_020971.3(SPTBN4):​c.2052_2071dupAGCGGGCGGCGCGCATGACC​(p.Leu691fs) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 33)
• Consequence: SPTBN4 NM_020971.3 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 2.44

Genes affected

SPTBN4 (HGNC:14896): (spectrin beta, non-erythrocytic 4) Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is composed of two antiparallel dimers of alpha- and beta- subunits. This gene is one member of a family of beta-spectrin genes. The encoded protein localizes to the nuclear matrix, PML nuclear bodies, and cytoplasmic vesicles. A highly similar gene in the mouse is required for localization of specific membrane proteins in polarized regions of neurons. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 19-40512839-A-ACAGCGGGCGGCGCGCATGAC is Pathogenic according to our data. Variant chr19-40512839-A-ACAGCGGGCGGCGCGCATGAC is described in ClinVar as [Pathogenic]. Clinvar id is 521395.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
SPTBN4	NM_020971.3	c.2052_2071dupAGCGGGCGGCGCGCATGACC	p.Leu691fs	frameshift_variant	14/36	ENST00000598249.6	NP_066022.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
SPTBN4	ENST00000598249.6	c.2052_2071dupAGCGGGCGGCGCGCATGACC	p.Leu691fs	frameshift_variant	14/36	1	NM_020971.3	ENSP00000469242.1
SPTBN4	ENST00000352632.7	c.2052_2071dupAGCGGGCGGCGCGCATGACC	p.Leu691fs	frameshift_variant	14/36	5		ENSP00000263373.2
SPTBN4	ENST00000595535.5	c.2052_2071dupAGCGGGCGGCGCGCATGACC	p.Leu691fs	frameshift_variant	14/27	5		ENSP00000470693.1
SPTBN4	ENST00000597389.5	n.228_247dupAGCGGGCGGCGCGCATGACC		non_coding_transcript_exon_variant	1/24	5		ENSP00000472136.1

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome Cov.: 31

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Inborn genetic diseases Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

Ambry Genetics

May 10, 2018

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555815437; hg19: chr19-41018746;