rs1555851445

Variant names:

• chr20-63408413-CTGCTTCTCCACCTTCCCGAGCCGTCCCATCA-C
• rs1555851445
• NM_172107.4:c.1856_1886delTGATGGGACGGCTCGGGAAGGTGGAGAAGCA

Variant summary

Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1

The NM_172107.4(KCNQ2):​c.1856_1886delTGATGGGACGGCTCGGGAAGGTGGAGAAGCA​(p.Met619ArgfsTer13) variant causes a frameshift, splice region change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as not provided (no stars).

• Frequency: Genomes: not found (cov: 32)
• Consequence: KCNQ2 NM_172107.4 frameshift, splice_region
• Clinical Significance: not provided no classification provided O:1
• Conservation: PhyloP100: 7.76
• Publications: 0 publications found

Genes affected

KCNQ2 (HGNC:6296): (potassium voltage-gated channel subfamily Q member 2) The M channel is a slowly activating and deactivating potassium channel that plays a critical role in the regulation of neuronal excitability. The M channel is formed by the association of the protein encoded by this gene and a related protein encoded by the KCNQ3 gene, both integral membrane proteins. M channel currents are inhibited by M1 muscarinic acetylcholine receptors and activated by retigabine, a novel anti-convulsant drug. Defects in this gene are a cause of benign familial neonatal convulsions type 1 (BFNC), also known as epilepsy, benign neonatal type 1 (EBN1). At least five transcript variants encoding five different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

KCNQ2 Gene-Disease associations (from GenCC):

• complex neurodevelopmental disorder

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• developmental and epileptic encephalopathy, 7

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), G2P
• neonatal encephalopathy with non-epileptic myoclonus

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• neonatal-onset developmental and epileptic encephalopathy

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• seizures, benign familial neonatal, 1

  Inheritance: AD Classification: DEFINITIVE Submitted by: G2P
• seizures, benign familial neonatal, 2

  Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
• benign familial infantile epilepsy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• benign familial neonatal-infantile seizures

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• benign neonatal seizures

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• malignant migrating partial seizures of infancy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_pathogenic. The variant received 8 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most 50 bp of the penultimate exon, not predicted to undergo nonsense mediated mRNA decay. There are 79 pathogenic variants in the truncated region.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_172107.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	KCNQ2	NM_172107.4	MANE Select	c.1856_1886delTGATGGGACGGCTCGGGAAGGTGGAGAAGCA	p.Met619ArgfsTer13	frameshift splice_region	Exon 16 of 17	NP_742105.1
	KCNQ2	NM_001382235.1		c.1910_1940delTGATGGGACGGCTCGGGAAGGTGGAGAAGCA	p.Met637ArgfsTer13	frameshift splice_region	Exon 16 of 17	NP_001369164.1
	KCNQ2	NM_172106.3		c.1802_1832delTGATGGGACGGCTCGGGAAGGTGGAGAAGCA	p.Met601ArgfsTer13	frameshift splice_region	Exon 15 of 16	NP_742104.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	KCNQ2	ENST00000359125.7	TSL:1 MANE Select	c.1856_1886delTGATGGGACGGCTCGGGAAGGTGGAGAAGCA	p.Met619ArgfsTer13	frameshift splice_region	Exon 16 of 17	ENSP00000352035.2
	KCNQ2	ENST00000626839.2	TSL:1	c.1802_1832delTGATGGGACGGCTCGGGAAGGTGGAGAAGCA	p.Met601ArgfsTer13	frameshift splice_region	Exon 15 of 16	ENSP00000486706.1
	KCNQ2	ENST00000344462.8	TSL:1	c.1763_1793delTGATGGGACGGCTCGGGAAGGTGGAGAAGCA	p.Met588ArgfsTer13	frameshift splice_region	Exon 15 of 16	ENSP00000339611.4

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions as Germline

Significance: not provided

Revision: no classification provided

Pathogenic	VUS	Benign	Condition
-	-	-	Seizures, benign familial neonatal, 1 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		7.8
Mutation Taster		=1/199	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555851445; hg19: chr20-62039766;