rs1555858801

Variant names:

• chr20-44160273-TGCTGTGCTCGCTGCGCAGGGA-G
• rs1555858801
• NM_020433.5:c.493_514delTCCCTGCGCAGCGAGCACAGCAinsC

Variant summary

Our verdict is Uncertain significance. The variant received 5 ACMG points: 5P and 0B. PM1 PM4 PP3

The ENST00000372980.4(JPH2):​c.493_514delTCCCTGCGCAGCGAGCACAGCAinsC​(p.Ser165_Asn172delinsHis) variant causes a missense, conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. S165S) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 32)
• Consequence: JPH2 ENST00000372980.4 missense, conservative_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 9.29
• Publications: 1 publications found

Genes affected

JPH2 (HGNC:14202): (junctophilin 2) Junctional complexes between the plasma membrane and endoplasmic/sarcoplasmic reticulum are a common feature of all excitable cell types and mediate cross talk between cell surface and intracellular ion channels. The protein encoded by this gene is a component of junctional complexes and is composed of a C-terminal hydrophobic segment spanning the endoplasmic/sarcoplasmic reticulum membrane and a remaining cytoplasmic domain that shows specific affinity for the plasma membrane. This gene is a member of the junctophilin gene family. Alternative splicing has been observed at this locus and two variants encoding distinct isoforms are described. [provided by RefSeq, Jul 2008]

JPH2 Gene-Disease associations (from GenCC):

• hypertrophic cardiomyopathy 17

  Inheritance: AD Classification: STRONG, MODERATE Submitted by: PanelApp Australia, Labcorp Genetics (formerly Invitae)
• cardiomyopathy, dilated, 2E

  Inheritance: Unknown, AR Classification: STRONG, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics
• hypertrophic cardiomyopathy

  Inheritance: AD Classification: MODERATE Submitted by: ClinGen
• dilated cardiomyopathy

  Inheritance: SD Classification: MODERATE Submitted by: ClinGen

ACMG classification

Our verdict: Uncertain_significance. The variant received 5 ACMG points.

• PM1: In a hotspot region, there are 3 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 0 benign, 15 uncertain in ENST00000372980.4
• PM4: Nonframeshift variant in NON repetitive region in ENST00000372980.4.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Variant Effect in Transcripts

ACMG analysis was done for transcript: ENST00000372980.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	JPH2	NM_020433.5	MANE Select	c.493_514delTCCCTGCGCAGCGAGCACAGCAinsC	p.Ser165_Asn172delinsHis	missense conservative_inframe_deletion	Exon 2 of 6	NP_065166.2

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	JPH2	ENST00000372980.4	TSL:5 MANE Select	c.493_514delTCCCTGCGCAGCGAGCACAGCAinsC	p.Ser165_Asn172delinsHis	missense conservative_inframe_deletion	Exon 2 of 6	ENSP00000362071.3

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions as Germline

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	Hypertrophic cardiomyopathy (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555858801; hg19: chr20-42788913;