rs1555972943
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_000475.5(NR0B1):c.1168+1_1168+20delGTAAGGGTACTGGCCTTAGG variant causes a splice donor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★).
Frequency
Consequence
NM_000475.5 splice_donor, splice_region, intron
Scores
Clinical Significance
Conservation
Publications
- X-linked adrenal hypoplasia congenitaInheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Myriad Women's Health, Labcorp Genetics (formerly Invitae), Ambry Genetics, Orphanet, G2P
- 46,XY sex reversal 2Inheritance: XL Classification: MODERATE Submitted by: Ambry Genetics
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000475.5. You can select a different transcript below to see updated ACMG assignments.
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| NR0B1 | TSL:1 MANE Select | c.1168+1_1168+20delGTAAGGGTACTGGCCTTAGG | splice_donor splice_region intron | N/A | ENSP00000368253.4 | P51843-1 | |||
| NR0B1 | TSL:2 | c.283+1_283+20delGTAAGGGTACTGGCCTTAGG | splice_donor splice_region intron | N/A | ENSP00000368246.1 | A6NNU8 |
Frequencies
GnomAD3 genomes Cov.: 23
GnomAD4 genome Cov.: 23
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.