rs1555972943

Variant summary

Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1PM2PP5_Very_Strong

The NM_000475.5(NR0B1):​c.1168+1_1168+20delGTAAGGGTACTGGCCTTAGG variant causes a splice donor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★★).

Frequency

Genomes: not found (cov: 23)

Consequence

NR0B1
NM_000475.5 splice_donor, splice_region, intron

Scores

Not classified

Clinical Significance

Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:2

Conservation

PhyloP100: 2.08
Variant links:
Genes affected
NR0B1 (HGNC:7960): (nuclear receptor subfamily 0 group B member 1) This gene encodes a protein that contains a DNA-binding domain. The encoded protein acts as a dominant-negative regulator of transcription which is mediated by the retinoic acid receptor. This protein also functions as an anti-testis gene by acting antagonistically to Sry. Mutations in this gene result in both X-linked congenital adrenal hypoplasia and hypogonadotropic hypogonadism. [provided by RefSeq, Jul 2008]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 18 ACMG points.

PVS1
Splicing +-2 bp (donor or acceptor) variant, LoF is a know mechanism of disease,
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant X-30308175-GCCTAAGGCCAGTACCCTTAC-G is Pathogenic according to our data. Variant chrX-30308175-GCCTAAGGCCAGTACCCTTAC-G is described in ClinVar as [Likely_pathogenic]. Clinvar id is 492857.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
NR0B1NM_000475.5 linkc.1168+1_1168+20delGTAAGGGTACTGGCCTTAGG splice_donor_variant, splice_region_variant, intron_variant Intron 1 of 1 ENST00000378970.5 NP_000466.2 P51843-1F1D8P4

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
NR0B1ENST00000378970.5 linkc.1168+1_1168+20delGTAAGGGTACTGGCCTTAGG splice_donor_variant, splice_region_variant, intron_variant Intron 1 of 1 1 NM_000475.5 ENSP00000368253.4 P51843-1
NR0B1ENST00000378963.1 linkc.283+1_283+20delGTAAGGGTACTGGCCTTAGG splice_donor_variant, splice_region_variant, intron_variant Intron 1 of 1 2 ENSP00000368246.1 A6NNU8

Frequencies

GnomAD3 genomes
Cov.:
23
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
23

ClinVar

Significance: Pathogenic/Likely pathogenic
Submissions summary: Pathogenic:2
Revision: criteria provided, multiple submitters, no conflicts
LINK: link

Submissions by phenotype

Congenital adrenal hypoplasia, X-linked Pathogenic:1
Oct 27, 2017
Clinical Molecular Genetics Laboratory, Johns Hopkins All Children's Hospital
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

- -

Congenital adrenal hypoplasia, X-linked;C1848296:46,XY sex reversal 2 Pathogenic:1
Apr 06, 2022
Labcorp Genetics (formerly Invitae), Labcorp
Significance: Likely pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

In summary, the currently available evidence indicates that the variant is pathogenic, but additional data are needed to prove that conclusively. Therefore, this variant has been classified as Likely Pathogenic. This variant disrupts the C-terminus of the NR0B1 protein. Other variant(s) that disrupt this region (p.Gln395*, p.Asp459Glyfs*3, p.Ser431Ilefs*6) have been observed in individuals with NR0B1-related conditions (PMID: 7609262, 8855822). This suggests that this may be a clinically significant region of the protein. Variants that disrupt the consensus splice site are a relatively common cause of aberrant splicing (PMID: 17576681, 9536098). Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may disrupt the consensus splice site. ClinVar contains an entry for this variant (Variation ID: 492857). This variant has not been reported in the literature in individuals affected with NR0B1-related conditions. This variant is not present in population databases (gnomAD no frequency). This sequence change affects a splice site in intron 1 of the NR0B1 gene. While this variant is not anticipated to result in nonsense mediated decay, it likely alters RNA splicing and results in a disrupted protein product. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1555972943; hg19: chrX-30326292; API