rs1555972943

Variant names:

• chrX-30308175-GCCTAAGGCCAGTACCCTTAC-G
• rs1555972943
• NM_000475.5:c.1168+1_1168+20delGTAAGGGTACTGGCCTTAGG

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_000475.5(NR0B1):​c.1168+1_1168+20delGTAAGGGTACTGGCCTTAGG variant causes a splice donor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★).

• Frequency: Genomes: not found (cov: 23)
• Consequence: NR0B1 NM_000475.5 splice_donor, splice_region, intron
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:2
• Conservation: PhyloP100: 2.08
• Publications: 1 publications found

Genes affected

NR0B1 (HGNC:7960): (nuclear receptor subfamily 0 group B member 1) This gene encodes a protein that contains a DNA-binding domain. The encoded protein acts as a dominant-negative regulator of transcription which is mediated by the retinoic acid receptor. This protein also functions as an anti-testis gene by acting antagonistically to Sry. Mutations in this gene result in both X-linked congenital adrenal hypoplasia and hypogonadotropic hypogonadism. [provided by RefSeq, Jul 2008]

NR0B1 Gene-Disease associations (from GenCC):

• X-linked adrenal hypoplasia congenita

  Inheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: G2P, Orphanet, Labcorp Genetics (formerly Invitae), Ambry Genetics, Myriad Women’s Health
• 46,XY sex reversal 2

  Inheritance: XL Classification: MODERATE Submitted by: Ambry Genetics

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, LoF is a know mechanism of disease,
• PP5: Variant X-30308175-GCCTAAGGCCAGTACCCTTAC-G is Pathogenic according to our data. Variant chrX-30308175-GCCTAAGGCCAGTACCCTTAC-G is described in ClinVar as Pathogenic/Likely_pathogenic. ClinVar VariationId is 492857.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000475.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	NR0B1	NM_000475.5	MANE Select	c.1168+1_1168+20delGTAAGGGTACTGGCCTTAGG		splice_donor splice_region intron	N/A	NP_000466.2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	NR0B1	ENST00000378970.5	TSL:1 MANE Select	c.1168+1_1168+20delGTAAGGGTACTGGCCTTAGG		splice_donor splice_region intron	N/A	ENSP00000368253.4	P51843-1
	NR0B1	ENST00000378963.1	TSL:2	c.283+1_283+20delGTAAGGGTACTGGCCTTAGG		splice_donor splice_region intron	N/A	ENSP00000368246.1	A6NNU8

Frequencies

GnomAD3 genomes Cov.: 23

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 23

ClinVar

ClinVar submissions

Significance: Pathogenic/Likely pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
1	-	-	Congenital adrenal hypoplasia, X-linked (1)
1	-	-	Congenital adrenal hypoplasia, X-linked;C1848296:46,XY sex reversal 2 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.1
Mutation Taster		=0/100	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555972943; hg19: chrX-30326292;