rs1556000892

Variant names:

• chrX-18920182-AAAGGTTCCCTAATTTTACTCTGCCAAG-A
• rs1556000892
• NM_000292.3:c.1794-8_1812delCTTGGCAGAGTAAAATTAGGGAACCTT

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1 PM2 PP5_Moderate

The NM_000292.3(PHKA2):​c.1794-8_1812delCTTGGCAGAGTAAAATTAGGGAACCTT​(p.Arg598fs) variant causes a frameshift, splice acceptor, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 23)
• Consequence: PHKA2 NM_000292.3 frameshift, splice_acceptor, splice_region, intron
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 8.49

Genes affected

PHKA2 (HGNC:8926): (phosphorylase kinase regulatory subunit alpha 2) Phosphorylase kinase is a polymer of 16 subunits, four each of alpha, beta, gamma and delta. The alpha subunit includes the skeletal muscle and hepatic isoforms, and the hepatic isoform is encoded by this gene. The beta subunit is the same in both the muscle and hepatic isoforms, and encoded by one gene. The gamma subunit also includes the skeletal muscle and hepatic isoforms, which are encoded by two different genes. The delta subunit is a calmodulin and can be encoded by three different genes. The gamma subunits contain the active site of the enzyme, whereas the alpha and beta subunits have regulatory functions controlled by phosphorylation. The delta subunit mediates the dependence of the enzyme on calcium concentration. Mutations in this gene cause glycogen storage disease type 9A, also known as X-linked liver glycogenosis. Alternatively spliced transcript variants have been reported, but the full-length nature of these variants has not been determined.[provided by RefSeq, Feb 2010]

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant X-18920182-AAAGGTTCCCTAATTTTACTCTGCCAAG-A is Pathogenic according to our data. Variant chrX-18920182-AAAGGTTCCCTAATTTTACTCTGCCAAG-A is described in ClinVar as [Pathogenic]. Clinvar id is 526623.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
PHKA2	NM_000292.3	c.1794-8_1812delCTTGGCAGAGTAAAATTAGGGAACCTT	p.Arg598fs	frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant	Exon 18 of 33	ENST00000379942.5	NP_000283.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
PHKA2	ENST00000379942.5	c.1794-8_1812delCTTGGCAGAGTAAAATTAGGGAACCTT	p.Arg598fs	frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant	Exon 18 of 33	1	NM_000292.3	ENSP00000369274.4

Frequencies

GnomAD3 genomes Cov.: 23

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 23

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Glycogen storage disease IXa1 Pathogenic:1

Nov 08, 2017

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant is a gross deletion of the genomic region encompassing part of exon 18 of the PHKA2 gene, including the intron 17-exon 18 boundary (c.1794-8_1812del). This likely creates a premature translational stop signal and is expected to result in an absent or disrupted protein product. This variant is not present in population databases (ExAC no frequency). This variant has not been reported in the literature in individuals with PHKA2-related disease. Loss-of-function variants in PHKA2 are known to be pathogenic (PMID: 7711737, 10330341). For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1556000892; hg19: chrX-18938300;