rs1556000892
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate
The NM_000292.3(PHKA2):c.1794-8_1812delCTTGGCAGAGTAAAATTAGGGAACCTT(p.Arg598fs) variant causes a frameshift, splice acceptor, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_000292.3 frameshift, splice_acceptor, splice_region, intron
Scores
Clinical Significance
Conservation
Publications
- glycogen storage disease IXa1Inheritance: XL Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp, Ambry Genetics
- glycogen storage disease due to liver phosphorylase kinase deficiencyInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000292.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| PHKA2 | MANE Select | c.1794-8_1812delCTTGGCAGAGTAAAATTAGGGAACCTT | p.Arg598fs | frameshift splice_acceptor splice_region intron | Exon 18 of 33 | NP_000283.1 | P46019 | ||
| PHKA2 | c.1794-8_1812delCTTGGCAGAGTAAAATTAGGGAACCTT | p.Arg598fs | frameshift splice_acceptor splice_region intron | Exon 18 of 33 | NP_001427734.1 | ||||
| PHKA2 | c.1794-8_1812delCTTGGCAGAGTAAAATTAGGGAACCTT | p.Arg598fs | frameshift splice_acceptor splice_region intron | Exon 18 of 32 | NP_001427729.1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| PHKA2 | TSL:1 MANE Select | c.1794-8_1812delCTTGGCAGAGTAAAATTAGGGAACCTT | p.Arg598fs | frameshift splice_acceptor splice_region intron | Exon 18 of 33 | ENSP00000369274.4 | P46019 | ||
| PHKA2 | c.1794-8_1812delCTTGGCAGAGTAAAATTAGGGAACCTT | p.Arg598fs | frameshift splice_acceptor splice_region intron | Exon 18 of 33 | ENSP00000567927.1 | ||||
| PHKA2 | c.1794-8_1812delCTTGGCAGAGTAAAATTAGGGAACCTT | p.Arg598fs | frameshift splice_acceptor splice_region intron | Exon 18 of 33 | ENSP00000624789.1 |
Frequencies
GnomAD3 genomes Cov.: 23
GnomAD4 genome Cov.: 23
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at