rs1556055511

Variant names:

• chrX-25013230-GTCGTCCTCCAGCAGCTCCTCCTCGTCGTCCTCCAGCAGTTCCTCTTCCTCGTCCTCATCTTCT-G
• rs1556055511
• NM_139058.3:c.702_764delAGAAGATGAGGACGAGGAAGAGGAACTGCTGGAGGACGACGAGGAGGAGCTGCTGGAGGACGA

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_139058.3(ARX):​c.702_764delAGAAGATGAGGACGAGGAAGAGGAACTGCTGGAGGACGACGAGGAGGAGCTGCTGGAGGACGA​(p.Glu234_Asp254del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: not found (cov: 23)
  • Exomes 𝑓: 0.0000019 (0 hom. 0 hem.)
  • Failed GnomAD Quality Control
• Consequence: ARX NM_139058.3 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 2.58
• Publications: 0 publications found

Genes affected

ARX (HGNC:18060): (aristaless related homeobox) This gene is a homeobox-containing gene expressed during development. The expressed protein contains two conserved domains, a C-peptide (or aristaless domain) and the prd-like class homeobox domain. It is a member of the group-II aristaless-related protein family whose members are expressed primarily in the central and/or peripheral nervous system. This gene is thought to be involved in CNS development. Expansion of a polyalanine tract and other mutations in this gene cause X-linked cognitive disability and epilepsy. [provided by RefSeq, Jul 2016]

ARX Gene-Disease associations (from GenCC):

• genetic developmental and epileptic encephalopathy

  Inheritance: XL, AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
• intellectual disability, X-linked, with or without seizures, ARX-related

  Inheritance: XL Classification: DEFINITIVE, MODERATE Submitted by: Ambry Genetics, G2P
• Partington syndrome

  Inheritance: XL Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, Orphanet
• X-linked complex neurodevelopmental disorder

  Inheritance: XL Classification: DEFINITIVE Submitted by: ClinGen
• X-linked lissencephaly with abnormal genitalia

  Inheritance: XL Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), Orphanet, Genomics England PanelApp
• infantile spasms

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• corpus callosum agenesis-abnormal genitalia syndrome

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• infantile epileptic-dyskinetic encephalopathy

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• non-syndromic X-linked intellectual disability

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• X-linked spasticity-intellectual disability-epilepsy syndrome

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ARX	NM_139058.3	c.702_764delAGAAGATGAGGACGAGGAAGAGGAACTGCTGGAGGACGACGAGGAGGAGCTGCTGGAGGACGA	p.Glu234_Asp254del	disruptive_inframe_deletion	Exon 2 of 5	ENST00000379044.5	NP_620689.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ARX	ENST00000379044.5	c.702_764delAGAAGATGAGGACGAGGAAGAGGAACTGCTGGAGGACGACGAGGAGGAGCTGCTGGAGGACGA	p.Glu234_Asp254del	disruptive_inframe_deletion	Exon 2 of 5	1	NM_139058.3	ENSP00000368332.4

Frequencies

GnomAD3 genomes Cov.: 23

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000191 AC: 2 AN: 1046681 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 336661

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 25258

American (AMR) AF: 0.00 AC: 0 AN: 29239

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 18651

East Asian (EAS) AF: 0.00 AC: 0 AN: 27876

South Asian (SAS) AF: 0.00 AC: 0 AN: 50155

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 30754

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 3241

European-Non Finnish (NFE) AF: 0.00000245 AC: 2 AN: 817206

Other (OTH) AF: 0.00 AC: 0 AN: 44301

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.00000000770867), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome Cov.: 23

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Intellectual disability, X-linked, with or without seizures, ARX-related;C3463992:Developmental and epileptic encephalopathy, 1 Uncertain:1

Jan 15, 2022

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.702_764del, results in the deletion of 21 amino acid(s) of the ARX protein (p.Glu234_Asp254del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with ARX-related conditions. ClinVar contains an entry for this variant (Variation ID: 540221). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.6

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1556055511; hg19: chrX-25031347;