rs1556055511

Variant names:

• chrX-25013230-GTCGTCCTCCAGCAGCTCCTCCTCGTCGTCCTCCAGCAGTTCCTCTTCCTCGTCCTCATCTTCT-G
• rs1556055511
• NM_139058.3:c.702_764delAGAAGATGAGGACGAGGAAGAGGAACTGCTGGAGGACGACGAGGAGGAGCTGCTGGAGGACGA

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2

The NM_139058.3(ARX):​c.702_764delAGAAGATGAGGACGAGGAAGAGGAACTGCTGGAGGACGACGAGGAGGAGCTGCTGGAGGACGA​(p.Glu234_Asp254del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: not found (cov: 23)
  • Exomes 𝑓: 0.0000019 (0 hom. 0 hem.)
  • Failed GnomAD Quality Control
• Consequence: ARX NM_139058.3 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 2.58

Genes affected

ARX (HGNC:18060): (aristaless related homeobox) This gene is a homeobox-containing gene expressed during development. The expressed protein contains two conserved domains, a C-peptide (or aristaless domain) and the prd-like class homeobox domain. It is a member of the group-II aristaless-related protein family whose members are expressed primarily in the central and/or peripheral nervous system. This gene is thought to be involved in CNS development. Expansion of a polyalanine tract and other mutations in this gene cause X-linked cognitive disability and epilepsy. [provided by RefSeq, Jul 2016]

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ARX	NM_139058.3	c.702_764delAGAAGATGAGGACGAGGAAGAGGAACTGCTGGAGGACGACGAGGAGGAGCTGCTGGAGGACGA	p.Glu234_Asp254del	disruptive_inframe_deletion	Exon 2 of 5	ENST00000379044.5	NP_620689.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ARX	ENST00000379044.5	c.702_764delAGAAGATGAGGACGAGGAAGAGGAACTGCTGGAGGACGACGAGGAGGAGCTGCTGGAGGACGA	p.Glu234_Asp254del	disruptive_inframe_deletion	Exon 2 of 5	1	NM_139058.3	ENSP00000368332.4

Frequencies

GnomAD3 genomes Cov.: 23

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000191 AC: 2 AN: 1046681 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 336661

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000245

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 23

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Intellectual disability, X-linked, with or without seizures, ARX-related;C3463992:Developmental and epileptic encephalopathy, 1 Uncertain:1

Jan 15, 2022

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.702_764del, results in the deletion of 21 amino acid(s) of the ARX protein (p.Glu234_Asp254del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with ARX-related conditions. ClinVar contains an entry for this variant (Variation ID: 540221). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1556055511; hg19: chrX-25031347;